Transcript: Human NM_001256213.1

Homo sapiens ATPase Na+/K+ transporting subunit alpha 3 (ATP1A3), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
ATP1A3 (478)
Length:
3504
CDS:
37..3111

Additional Resources:

NCBI RefSeq record:
NM_001256213.1
NBCI Gene record:
ATP1A3 (478)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001256213.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000072787 CGACGAAATCCGCAAACTCAT pLKO.1 3042 CDS 100% 4.950 6.930 N ATP1A3 n/a
2 TRCN0000072785 CGACTGTGATGACGTGAACTT pLKO.1 1752 CDS 100% 4.950 6.930 N ATP1A3 n/a
3 TRCN0000072783 CAAACCTCTCTCCTCTCTCTT pLKO.1 3293 3UTR 100% 4.950 3.465 N ATP1A3 n/a
4 TRCN0000072786 CGGACGGACAAATTGGTCAAT pLKO.1 2557 CDS 100% 4.950 3.465 N ATP1A3 n/a
5 TRCN0000072784 GCCTTCTTTGTGAGCATCGTT pLKO.1 2800 CDS 100% 3.000 2.100 N ATP1A3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001256213.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05865 pDONR223 100% 98.8% 98.7% None 6_38del;699T>G n/a
2 ccsbBroad304_05865 pLX_304 0% 98.8% 98.7% V5 6_38del;699T>G n/a
3 TRCN0000466545 AATTCATCGCCTCCCAAGTTGATG pLX_317 12.6% 98.8% 98.7% V5 6_38del;699T>G n/a
4 ccsbBroadEn_05864 pDONR223 100% 81.1% 86.7% None (many diffs) n/a
Download CSV