Transcript: Human NM_001256822.1

Homo sapiens septin 4 (SEPTIN4), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-07-10
Taxon:
Homo sapiens (human)
Gene:
SEPTIN4 (5414)
Length:
1777
CDS:
604..1599

Additional Resources:

NCBI RefSeq record:
NM_001256822.1
NBCI Gene record:
SEPTIN4 (5414)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001256822.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000164795 CCCTAAAGGAAAGCATCCCAT pLKO.1 1172 CDS 100% 2.640 3.696 N SEPTIN4 n/a
2 TRCN0000165287 GTGGACCACAAGAAACGCAAA pLKO.1 1057 CDS 100% 4.050 3.240 N SEPTIN4 n/a
3 TRCN0000441026 AGGAACGGAATCGCAACAAAC pLKO_005 1424 CDS 100% 10.800 7.560 N Sept4 n/a
4 TRCN0000161166 GAGCAAGTTCGTGAAGGATTT pLKO.1 264 5UTR 100% 10.800 7.560 N SEPTIN4 n/a
5 TRCN0000161680 GCAAGCTTGATCCCTATGATT pLKO.1 491 5UTR 100% 5.625 3.938 N SEPTIN4 n/a
6 TRCN0000164742 CATTGTGGACACACCAGGTTT pLKO.1 777 CDS 100% 4.950 3.465 N SEPTIN4 n/a
7 TRCN0000101736 CCTAAAGGAAAGCATCCCATT pLKO.1 1173 CDS 100% 4.050 2.835 N Sept4 n/a
8 TRCN0000160749 CCTAAAGGAAAGCATCCCATT pLKO.1 1173 CDS 100% 4.050 2.835 N SEPTIN4 n/a
9 TRCN0000165540 GCTGAAGAGAGGATCATGCAA pLKO.1 694 CDS 100% 3.000 2.100 N SEPTIN4 n/a
10 TRCN0000101737 CCGGCCATTGGATGTTGAATT pLKO.1 963 CDS 100% 0.000 0.000 N Sept4 n/a
11 TRCN0000161444 CGTGAAGGATTTCTCAGGAAA pLKO.1 273 5UTR 100% 4.950 2.970 N SEPTIN4 n/a
12 TRCN0000165317 GATGCAGGAGATGCTACACAA pLKO.1 1548 CDS 100% 4.950 2.970 N SEPTIN4 n/a
13 TRCN0000164663 CTGAGCAAGTTCGTGAAGGAT pLKO.1 262 5UTR 100% 3.000 1.800 N SEPTIN4 n/a
14 TRCN0000433206 TGCATCAGCGGGTCAACATTG pLKO_005 995 CDS 100% 10.800 7.560 N Sept4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001256822.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01233 pDONR223 100% 69.2% 69.2% None 0_1ins441 n/a
2 ccsbBroad304_01233 pLX_304 0% 69.2% 69.2% V5 0_1ins441 n/a
3 TRCN0000481592 ATGCAACTCATTTCAGGTCCTCCG pLX_317 29.2% 62.4% 56% V5 (not translated due to prior stop codon) 0_1ins441;836_837ins155 n/a
4 TRCN0000476347 CCATTTCCAACTATGATTTCGGGC pLX_317 25.8% 62.4% 56% V5 (not translated due to prior stop codon) 0_1ins441;836_837ins155 n/a
Download CSV