Construct: ORF TRCN0000476347
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF003958.1_s317c1
- Derived from:
- ccsbBroadEn_01233
- DNA Barcode:
- CCATTTCCAACTATGATTTCGGGC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Early stop codon detected
Originally Annotated References:
- Gene:
- SEPTIN4 (5414)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000476347
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 5414 | SEPTIN4 | septin 4 | NM_004574.4 | 90.2% | 84.9% | 1277_1278ins155 |
| 2 | human | 5414 | SEPTIN4 | septin 4 | NM_001198713.1 | 88.1% | 80.8% | (many diffs) |
| 3 | human | 5414 | SEPTIN4 | septin 4 | NM_001368772.1 | 88% | 81.2% | (many diffs) |
| 4 | human | 5414 | SEPTIN4 | septin 4 | XM_006721949.3 | 87.6% | 80.9% | (many diffs) |
| 5 | human | 5414 | SEPTIN4 | septin 4 | NM_080416.3 | 86.5% | 80.9% | 1_2delATins59;1220_1221ins155 |
| 6 | human | 5414 | SEPTIN4 | septin 4 | XR_002958032.1 | 86.2% | (many diffs) | |
| 7 | human | 5414 | SEPTIN4 | septin 4 | NM_001256782.1 | 85.9% | 79.6% | (many diffs) |
| 8 | human | 5414 | SEPTIN4 | septin 4 | XR_002958031.1 | 84% | (many diffs) | |
| 9 | human | 5414 | SEPTIN4 | septin 4 | XR_002958037.1 | 82.6% | (many diffs) | |
| 10 | human | 5414 | SEPTIN4 | septin 4 | NR_104196.1 | 77% | 1_293del;1883_2063del | |
| 11 | human | 5414 | SEPTIN4 | septin 4 | XR_002958034.1 | 76.2% | (many diffs) | |
| 12 | human | 5414 | SEPTIN4 | septin 4 | XR_002958039.1 | 75.9% | (many diffs) | |
| 13 | human | 5414 | SEPTIN4 | septin 4 | XR_002958036.1 | 72.8% | (many diffs) | |
| 14 | human | 5414 | SEPTIN4 | septin 4 | XR_002958033.1 | 72.5% | (many diffs) | |
| 15 | human | 5414 | SEPTIN4 | septin 4 | NR_104197.1 | 72% | (many diffs) | |
| 16 | human | 5414 | SEPTIN4 | septin 4 | NM_001363803.1 | 71.5% | 65.4% | 59_60ins297;980_981ins155 |
| 17 | human | 5414 | SEPTIN4 | septin 4 | XM_006721950.4 | 71.5% | 62.2% | (many diffs) |
| 18 | human | 5414 | SEPTIN4 | septin 4 | XM_006721952.3 | 67.9% | 61.5% | 0_1ins346;2_3insTCCTCTGA;923_924ins155 |
| 19 | human | 5414 | SEPTIN4 | septin 4 | NR_037155.2 | 65.3% | 1_293del;649_1016del;2251_2431del | |
| 20 | human | 5414 | SEPTIN4 | septin 4 | NM_001256822.1 | 62.4% | 56% | 0_1ins441;836_837ins155 |
| 21 | human | 5414 | SEPTIN4 | septin 4 | XM_006721954.3 | 62.4% | 56% | 0_1ins441;836_837ins155 |
| 22 | human | 5414 | SEPTIN4 | septin 4 | XM_006721955.3 | 62.4% | 56% | 0_1ins441;836_837ins155 |
| 23 | human | 5414 | SEPTIN4 | septin 4 | XM_011524911.1 | 62.4% | 56% | 0_1ins441;836_837ins155 |
| 24 | human | 5414 | SEPTIN4 | septin 4 | XM_011524912.2 | 62.4% | 56% | 0_1ins441;836_837ins155 |
| 25 | human | 5414 | SEPTIN4 | septin 4 | XM_024450807.1 | 62.4% | 56% | 0_1ins441;836_837ins155 |
| 26 | human | 5414 | SEPTIN4 | septin 4 | XM_024450808.1 | 62.4% | 56% | 0_1ins441;836_837ins155 |
| 27 | human | 5414 | SEPTIN4 | septin 4 | XR_002958040.1 | 53% | (many diffs) | |
| 28 | human | 5414 | SEPTIN4 | septin 4 | NM_080415.3 | 49% | 52.1% | (many diffs) |
| 29 | human | 5414 | SEPTIN4 | septin 4 | NM_001368771.2 | 44.8% | 40% | (many diffs) |
| 30 | human | 5414 | SEPTIN4 | septin 4 | XR_002958035.1 | 38.1% | (many diffs) | |
| 31 | human | 5414 | SEPTIN4 | septin 4 | XR_002958038.1 | 33% | 1_2289del;2396_2397ins250;3629_3802del | |
| 32 | mouse | 18952 | Sept4 | septin 4 | NM_011129.2 | 80.9% | 78.2% | (many diffs) |
| 33 | mouse | 18952 | Sept4 | septin 4 | XM_006532497.3 | 78.8% | 75.3% | (many diffs) |
| 34 | mouse | 18952 | Sept4 | septin 4 | NM_001368776.1 | 77.9% | 73.9% | (many diffs) |
| 35 | mouse | 18952 | Sept4 | septin 4 | NM_001361936.1 | 77.5% | 74.7% | (many diffs) |
| 36 | mouse | 18952 | Sept4 | septin 4 | NM_001284394.1 | 72.6% | 82.2% | (many diffs) |
| 37 | mouse | 18952 | Sept4 | septin 4 | XM_030245664.1 | 70.5% | 79.1% | (many diffs) |
| 38 | mouse | 18952 | Sept4 | septin 4 | NM_001368779.1 | 69.7% | 77.6% | (many diffs) |
| 39 | mouse | 18952 | Sept4 | septin 4 | NM_001368778.1 | 69.2% | 78.4% | (many diffs) |
| 40 | mouse | 18952 | Sept4 | septin 4 | NM_001284392.1 | 65.3% | 64.3% | (many diffs) |
| 41 | mouse | 18952 | Sept4 | septin 4 | XM_030245665.1 | 62.9% | 61.6% | (many diffs) |
| 42 | mouse | 18952 | Sept4 | septin 4 | NM_001368777.1 | 62% | 60.8% | (many diffs) |
| 43 | mouse | 18952 | Sept4 | septin 4 | XM_030245666.1 | 57% | 67.4% | (many diffs) |
| 44 | mouse | 18952 | Sept4 | septin 4 | XM_030245667.1 | 56.9% | 55.3% | (many diffs) |
| 45 | mouse | 18952 | Sept4 | septin 4 | NM_001284398.1 | 53.7% | 63.6% | (many diffs) |
| 46 | mouse | 18952 | Sept4 | septin 4 | XM_006532493.2 | 41.3% | 38% | (many diffs) |
| 47 | mouse | 18952 | Sept4 | septin 4 | NM_001368775.1 | 37% | 38.6% | (many diffs) |
| 48 | mouse | 18952 | Sept4 | septin 4 | XR_388364.2 | 34.9% | (many diffs) | |
| 49 | mouse | 18952 | Sept4 | septin 4 | XR_001779919.2 | 33.5% | (many diffs) | |
| 50 | mouse | 18952 | Sept4 | septin 4 | XM_030245663.1 | 25.4% | 23% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1506
- ORF length:
- 1437
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggaccgttca ctgggatggc aagggaattc tgtccctgag gacaggactg 121 aagctgggat caagcgtttc ctggaggaca ccacggatga tggagaactg agcaagttcg 181 tgaaggattt ctcaggaaat gcgagctgcc acccaccaga ggctaagacc tgggcatcca 241 ggccccaagt cccggagcca aggccccagg ccccggacct ctatgatgat gacctggagt 301 tcagaccccc ctcgcggccc cagtcctctg acaaccagca gtacttctgt gccccagccc 361 ctctcagccc atctgccagg ccccgcagcc catggggcaa gcttgatccc tatgattcct 421 ctgaggatga caaggagtat gtgggctttg caaccctccc caaccaagtc caccgaaagt 481 ccgtgaagaa aggctttgac tttaccctca tggtggcagg agagtctggc ctgggcaaat 541 ccacacttgt caatagcctc ttcctcactg atctgtaccg ggaccggaaa cttcttggtg 601 ctgaagagag gatcatgcaa actgtggaga tcactaagca tgcagtggac atagaagaga 661 agggtgtgag gctgcggctc accattgtgg acacaccagg ttttggggat gcagtcaaca 721 acacagagtg ctggaagcct gtggcagaat acattgatca gcagtttgag cagtatttcc 781 gagacgagag tggcctgaac cgaaagaaca tccaagacaa cagggtgcac tgctgcctgt 841 acttcatctc acccttcggc catgggctcc ggccattgga tgttgaattc atgaaggccc 901 tgcatcagcg ggtcaacatc gtgcctatcc tggctaaggc agacacactg acacctcccg 961 aagtggacca caagaaacgc aaaatccggg aggagattga gcattttgga atcaagatct 1021 atcaattccc agactgtgac tctgatgagg atgaggactt caaattgcag gaccaagccc 1081 taaaggaaag catcccattt gcagtaattg gcagcaacac tgtagtagag gccagagggc 1141 ggcgagttcg gggtcgactc tacccctggg gcatcgtgga agtggaaaac ccagggcact 1201 gcgactttgt gaagctgagg acaatgctgg tacgtaccca catgcaggac cTGAAGGATG 1261 TGACACGGGA GACACATTAT GAGAACTACC GGGCACAGTG CATCCAGAGC ATGACCCGCC 1321 TGGTGGTGAA GGAACGGAAT CGCAAGTATG ACCAGAAGCC AGGACAAAGC TGGCAGGGGG 1381 AGATCCCAAG CCTAGCCTTG GGTGAGACCA AGCCCTACTT TTGTTCTTCT ATAGGCCCTG 1441 GGCTCAATCT AAGCGGGTGC TGGGGTCCTC CTCGCCTTAT CAACCCTTTT CTCCCTTTAG 1501 CAAACTGACT CGGGAAAGTG GTACCGACTT CCCCATCCCT GCTGTCCCAC CAGGGACAGA 1561 TCCAGAAACT GAGAAGCTTA TCCGAGAGAA AGATGAGGAG CTGCGGCGGA TGCAGGAGAT 1621 GCTACACAAA ATACAAAAAC AGATGAAGGA GAACTATTTG CCAACTTTCT TGTACAAAGT 1681 GGTTGATATC GGTAAGCCTA TCCCTAACCC TCTCCTCGGT CTCGATTCTA CGTAGTAATG 1741 AACTAGTCCG TAACTTGAAA GTATTTCGAT TTCTTGGCTT TATATATCTT GTGGAAAGGA 1801 CGACCATTTC CAACTATGAT TTCGGGCACG CGTTAAGTCg acaatcaacc tctggattac 1861 aaaatttgtg aaagatt