Transcript: Human NM_001257395.2

Homo sapiens ubiquitin conjugating enzyme E2 V1 (UBE2V1), transcript variant 7, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
UBE2V1 (7335)
Length:
2101
CDS:
23..457

Additional Resources:

NCBI RefSeq record:
NM_001257395.2
NBCI Gene record:
UBE2V1 (7335)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001257395.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000033707 AGGACAGTGTTACAGCAATTA pLKO.1 436 CDS 100% 13.200 6.600 Y UBE2V1 n/a
2 TRCN0000426763 ATAGAATGTGGACCTAAATAC pLKO_005 218 CDS 100% 13.200 6.600 Y TMEM189-UBE2V1 n/a
3 TRCN0000420546 CGATTTAATCAGTCTTCATTT pLKO_005 499 3UTR 100% 13.200 6.600 Y TMEM189-UBE2V1 n/a
4 TRCN0000422529 TAAATTGATTCCCATCATAAC pLKO_005 728 3UTR 100% 10.800 5.400 Y TMEM189-UBE2V1 n/a
5 TRCN0000033708 CGCCTAATGATGTCTAAAGAA pLKO.1 389 CDS 100% 5.625 2.813 Y UBE2V1 n/a
6 TRCN0000033704 CCCTGGTTTCTTTAAGTCTTA pLKO.1 971 3UTR 100% 4.950 2.475 Y UBE2V1 n/a
7 TRCN0000033706 CCAAGAGCCATATCAGTGCTA pLKO.1 317 CDS 100% 2.640 1.320 Y UBE2V1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001257395.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01741 pDONR223 100% 97.9% 97.9% None 21_22insGGAGTAAAA n/a
2 ccsbBroad304_01741 pLX_304 0% 97.9% 97.9% V5 21_22insGGAGTAAAA n/a
3 TRCN0000468843 CTGAGCTAAAGGCTACTCTTGCGC pLX_317 82.6% 97.9% 97.9% V5 21_22insGGAGTAAAA n/a
4 ccsbBroadEn_01742 pDONR223 100% 82.6% 88.9% None (many diffs) n/a
5 ccsbBroad304_01742 pLX_304 0% 82.6% 88.9% V5 (many diffs) n/a
6 TRCN0000474497 GGCACAGCCACCCTAATTTTCGTC pLX_317 87.6% 82.6% 88.9% V5 (many diffs) n/a
Download CSV