Transcript: Human NM_001258248.2

Homo sapiens Sp6 transcription factor (SP6), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
SP6 (80320)
Length:
3824
CDS:
303..1433

Additional Resources:

NCBI RefSeq record:
NM_001258248.2
NBCI Gene record:
SP6 (80320)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001258248.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430765 GTCCCTTTCATCCCACTTAAA pLKO_005 1890 3UTR 100% 13.200 18.480 N SP6 n/a
2 TRCN0000017806 ACACCATTATGAATCGTGGTT pLKO.1 605 CDS 100% 2.640 3.696 N SP6 n/a
3 TRCN0000017804 CCGGACATGTCACACCATTAT pLKO.1 594 CDS 100% 13.200 10.560 N SP6 n/a
4 TRCN0000415693 GCTACTAGGCAGGATGAATTT pLKO_005 1608 3UTR 100% 13.200 9.240 N SP6 n/a
5 TRCN0000233990 TAACCTGCGAGGACCTGGAAA pLKO_005 529 CDS 100% 4.950 3.465 N Sp6 n/a
6 TRCN0000017803 GCATTTGCACAACTGCCACAT pLKO.1 1055 CDS 100% 4.050 2.835 N SP6 n/a
7 TRCN0000425981 AGTCTGCAGCCGCGTCTTCAT pLKO_005 1253 CDS 100% 1.650 1.155 N SP6 n/a
8 TRCN0000017805 CGGAGTCTCAAGGGCTGGATT pLKO.1 892 CDS 100% 1.650 1.155 N SP6 n/a
9 TRCN0000017807 CGCCAAGACGTCGCACCTGAA pLKO.1 1097 CDS 100% 0.000 0.000 N SP6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001258248.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04208 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04208 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000466987 TAGGGTTTGACCTTCGTCGAGAGG pLX_317 30.1% 100% 100% V5 n/a
Download CSV