Transcript: Human NM_001258269.1

Homo sapiens ubiquitously transcribed tetratricopeptide repeat containing, Y-linked (UTY), transcript variant 24, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
UTY (7404)
Length:
6394
CDS:
1006..4887

Additional Resources:

NCBI RefSeq record:
NM_001258269.1
NBCI Gene record:
UTY (7404)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001258269.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000229957 CCATAGTGATAGCCCATAAAT pLKO_005 6004 3UTR 100% 15.000 21.000 N UTY n/a
2 TRCN0000229955 GGCAACTAGCACTGGTATTAA pLKO_005 2715 CDS 100% 15.000 21.000 N UTY n/a
3 TRCN0000108115 CCCATAAATAATTGCTGGAAA pLKO.1 6016 3UTR 100% 4.950 6.930 N UTY n/a
4 TRCN0000108119 CTGGGCATGAATACAGTACAA pLKO.1 4078 CDS 100% 4.950 6.930 N UTY n/a
5 TRCN0000108116 GCGAGCAAATAGAGATAATTT pLKO.1 2523 CDS 100% 15.000 12.000 N UTY n/a
6 TRCN0000218022 GGATGCTTTACAGGCATATAT pLKO_005 2001 CDS 100% 15.000 9.000 N UTY n/a
7 TRCN0000229956 TCCACCCACACCTAGTATTTA pLKO_005 3510 CDS 100% 15.000 9.000 N UTY n/a
8 TRCN0000108118 CCTGGAATGTTGGTCCACTTA pLKO.1 4412 CDS 100% 4.950 2.970 N UTY n/a
9 TRCN0000218870 CTGGAATATGGCACGAAATAT pLKO_005 4521 CDS 100% 15.000 7.500 Y UTY n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001258269.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11214 pDONR223 100% 10.1% 6% None (many diffs) n/a
2 ccsbBroad304_11214 pLX_304 0% 10.1% 6% V5 (many diffs) n/a
3 TRCN0000479140 CGCTCCGGGTGGCCTTACCGTGTT pLX_317 89.4% 10.1% 6% V5 (many diffs) n/a
Download CSV