Transcript: Human NM_001258374.3

Homo sapiens epidermal growth factor receptor pathway substrate 15 like 1 (EPS15L1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
EPS15L1 (58513)
Length:
3216
CDS:
26..2758

Additional Resources:

NCBI RefSeq record:
NM_001258374.3
NBCI Gene record:
EPS15L1 (58513)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001258374.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000233082 TCGTTGTATGAATCTTATTAC pLKO_005 74 CDS 100% 13.200 18.480 N EPS15L1 n/a
2 TRCN0000233085 GAAGTCAACGCAAGACGAAAT pLKO_005 1624 CDS 100% 10.800 8.640 N EPS15L1 n/a
3 TRCN0000233084 GAGCATGCCACCGCCTAAATT pLKO_005 313 CDS 100% 15.000 10.500 N EPS15L1 n/a
4 TRCN0000233083 AGTCTGGCCTCTCGGACATTA pLKO_005 159 CDS 100% 13.200 9.240 N EPS15L1 n/a
5 TRCN0000053823 CCCAGTTACAAAGAGAGAAAT pLKO.1 1206 CDS 100% 13.200 9.240 N EPS15L1 n/a
6 TRCN0000233086 CAACTTCAACAGATCCATTTG pLKO_005 1980 CDS 100% 10.800 7.560 N EPS15L1 n/a
7 TRCN0000053826 CCTTGGGAAGATATGGGACTT pLKO.1 181 CDS 100% 4.050 2.835 N EPS15L1 n/a
8 TRCN0000053825 GCTCAGAAACAGGATGCTCAA pLKO.1 1343 CDS 100% 4.050 2.835 N EPS15L1 n/a
9 TRCN0000053827 CCATGAAGTTACCTTGAGCAA pLKO.1 283 CDS 100% 2.640 1.848 N EPS15L1 n/a
10 TRCN0000053824 CCTTCAAATCTGACCCATTTA pLKO.1 1899 CDS 100% 13.200 7.920 N EPS15L1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001258374.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12417 pDONR223 100% 82.7% 82.3% None (many diffs) n/a
2 ccsbBroad304_12417 pLX_304 0% 82.7% 82.3% V5 (many diffs) n/a
3 TRCN0000475127 TACCTGGATAGTCCGAACTCCGGC pLX_317 17.1% 82.7% 82.3% V5 (many diffs) n/a
4 ccsbBroadEn_12418 pDONR223 100% 65.9% 65.3% None (many diffs) n/a
5 ccsbBroad304_12418 pLX_304 0% 65.9% 65.3% V5 (many diffs) n/a
6 TRCN0000475982 TTCACTGTACTAGCTTGCTTTCTC pLX_317 15.1% 65.9% 65.3% V5 (many diffs) n/a
Download CSV