Transcript: Human NM_001261399.2

Homo sapiens proline rich protein BstNI subfamily 4 (PRB4), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
PRB4 (5545)
Length:
711
CDS:
38..574

Additional Resources:

NCBI RefSeq record:
NM_001261399.2
NBCI Gene record:
PRB4 (5545)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001261399.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000021928 TCTCTCTTCCTAATATCAGGA pLKO.1 119 CDS 100% 2.640 2.112 N PRB4 n/a
2 TRCN0000021926 CATCCAGGAAAGCCAGAAAGA pLKO.1 320 CDS 100% 4.950 3.465 N PRB4 n/a
3 TRCN0000021924 CAGGAAGTGAATAAGAAGATA pLKO.1 590 3UTR 100% 5.625 2.813 Y PRB4 n/a
4 TRCN0000147897 GATTCAATGACAGGAAGTGAA pLKO.1 580 3UTR 100% 4.950 2.475 Y PRB2 n/a
5 TRCN0000021927 TCTAGGATTCAATGACAGGAA pLKO.1 575 CDS 100% 2.640 1.320 Y PRB4 n/a
6 TRCN0000154500 GAAGATGTCAGCCAGGAAGAT pLKO.1 98 CDS 100% 4.950 2.475 Y PRH1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001261399.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06763 pDONR223 100% 73.1% 62.4% None (many diffs) n/a
2 ccsbBroad304_06763 pLX_304 0% 73.1% 62.4% V5 (many diffs) n/a
3 TRCN0000465570 AAGTGGGAGAGTAAGTGCCTGGTC pLX_317 83.2% 55.9% 55.6% V5 146_379del;418G>C n/a
4 ccsbBroadEn_06764 pDONR223 100% 53.4% 50.6% None (many diffs) n/a
5 ccsbBroad304_06764 pLX_304 0% 53.4% 50.6% V5 (many diffs) n/a
6 TRCN0000469220 CAAGGACAGTGCATGGTCCCCGAC pLX_317 16.1% 53.4% 50.6% V5 (many diffs) n/a
Download CSV