Transcript: Human NM_001263.4

Homo sapiens CDP-diacylglycerol synthase 1 (CDS1), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
CDS1 (1040)
Length:
4309
CDS:
276..1661

Additional Resources:

NCBI RefSeq record:
NM_001263.4
NBCI Gene record:
CDS1 (1040)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001263.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000035843 CCTGAACAGCAGTTAAATATA pLKO.1 1578 CDS 100% 15.000 21.000 N CDS1 n/a
2 TRCN0000426312 GATTCTGATATTCCGGAAATT pLKO_005 438 CDS 100% 13.200 18.480 N CDS1 n/a
3 TRCN0000426346 GAACACTAAGTTGGTACTTTC pLKO_005 703 CDS 100% 10.800 15.120 N CDS1 n/a
4 TRCN0000422151 CAACCCACCTTGAAGGTATAA pLKO_005 1641 CDS 100% 13.200 9.240 N CDS1 n/a
5 TRCN0000035839 GCATCTTTAATTGGCCCATTT pLKO.1 1362 CDS 100% 10.800 7.560 N CDS1 n/a
6 TRCN0000035840 GCTGCCTATGTGTTATCCAAA pLKO.1 1155 CDS 100% 4.950 3.465 N CDS1 n/a
7 TRCN0000035841 GCTTCCATGAAATTATCACTA pLKO.1 640 CDS 100% 4.950 3.465 N CDS1 n/a
8 TRCN0000035842 CCAGCGACAAAGAAACAGATA pLKO.1 382 CDS 100% 4.950 2.970 N CDS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001263.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00286 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00286 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000476870 CCTTATTCGGCCTCCTTTGTAGAA pLX_317 7.2% 100% 100% V5 n/a
Download CSV