Transcript: Human NM_001267047.1

Homo sapiens FERM domain containing 6 (FRMD6), transcript variant 4, mRNA.

Source:
NCBI, updated 2018-06-25
Taxon:
Homo sapiens (human)
Gene:
FRMD6 (122786)
Length:
3623
CDS:
117..911

Additional Resources:

NCBI RefSeq record:
NM_001267047.1
NBCI Gene record:
FRMD6 (122786)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001267047.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000143768 CCACAGACTATATGTCGGAAA pLKO.1 621 CDS 100% 4.050 5.670 N FRMD6 n/a
2 TRCN0000122114 CCTCGATGACATCAGACTTTA pLKO.1 674 CDS 100% 13.200 9.240 N FRMD6 n/a
3 TRCN0000167279 CCCTAAACATAGCTCTTTCTT pLKO.1 1009 3UTR 100% 5.625 3.938 N FRMD6 n/a
4 TRCN0000167165 CCACCATTTCTTATGGATGAT pLKO.1 2896 3UTR 100% 4.950 3.465 N FRMD6 n/a
5 TRCN0000168430 GCCATGATTCTCAACACTGAT pLKO.1 2000 3UTR 100% 4.950 3.465 N FRMD6 n/a
6 TRCN0000145454 GATGAAGTTCCAGAGTTTGTT pLKO.1 885 CDS 100% 5.625 3.375 N FRMD6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001267047.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13092 pDONR223 100% 99.8% 100% None 144G>A n/a
2 ccsbBroad304_13092 pLX_304 0% 99.8% 100% V5 144G>A n/a
3 TRCN0000480368 TACTCACCGTCTAAGAACTCTCCT pLX_317 49.1% 99.8% 100% V5 144G>A n/a
4 ccsbBroadEn_04766 pDONR223 100% 42.9% 42.9% None 0_1ins1050 n/a
5 TRCN0000492256 TTCGATCTACCATTTGATCTATAA pLX_317 25.9% 42.9% 42.9% V5 0_1ins1050 n/a
Download CSV