Transcript: Human NM_001267709.1

Homo sapiens zinc finger protein 706 (ZNF706), transcript variant 5, mRNA.

Source:
NCBI, updated 2018-06-25
Taxon:
Homo sapiens (human)
Gene:
ZNF706 (51123)
Length:
2668
CDS:
214..444

Additional Resources:

NCBI RefSeq record:
NM_001267709.1
NBCI Gene record:
ZNF706 (51123)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001267709.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000129711 CCTATTCTTATGCCCTTACTT pLKO.1 1909 3UTR 100% 5.625 7.875 N ZNF706 n/a
2 TRCN0000173891 GTCTGTAGGACACAAATGCCA pLKO.1 340 CDS 100% 0.750 1.050 N Zfp706 n/a
3 TRCN0000277184 GTCTGTAGGACACAAATGCCA pLKO_005 340 CDS 100% 0.750 1.050 N Zfp706 n/a
4 TRCN0000415011 GGGCTACAGAAACACTCATTT pLKO_005 555 3UTR 100% 13.200 9.240 N ZNF706 n/a
5 TRCN0000219803 TTCAGGCATAAGGTTGTTTAC pLKO.1 434 CDS 100% 10.800 7.560 N ZNF706 n/a
6 TRCN0000219802 CACAAATGCCAGACCCTAAGA pLKO.1 350 CDS 100% 4.950 3.465 N ZNF706 n/a
7 TRCN0000130253 CTTCCTCCAGAATTAGCTGAT pLKO.1 412 CDS 100% 4.050 2.835 N ZNF706 n/a
8 TRCN0000147852 GCCTTAATATATACCTGCACT pLKO.1 319 CDS 100% 2.640 1.848 N ZNF706 n/a
9 TRCN0000175288 CCAAAGCTGCCTTAATATATA pLKO.1 311 CDS 100% 15.000 9.000 N Zfp706 n/a
10 TRCN0000285884 CCAAAGCTGCCTTAATATATA pLKO_005 311 CDS 100% 15.000 9.000 N Zfp706 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001267709.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03219 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03219 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000465504 CCTACGACCGATCGCTCAAAGTCC pLX_317 100% 100% 100% V5 n/a
Download CSV