Transcript: Human NM_001267817.1

Homo sapiens oligosaccharyltransferase complex non-catalytic subunit (OSTC), transcript variant 2, mRNA.

Source:
NCBI, updated 2018-12-15
Taxon:
Homo sapiens (human)
Gene:
OSTC (58505)
Length:
894
CDS:
72..323

Additional Resources:

NCBI RefSeq record:
NM_001267817.1
NBCI Gene record:
OSTC (58505)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001267817.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000135378 GTCGGTTCTATGACTGATGAA pLKO.1 246 CDS 100% 4.950 6.930 N OSTC n/a
2 TRCN0000133728 GCTGTACCAATCCTCTAATAT pLKO.1 384 3UTR 100% 15.000 9.000 N OSTC n/a
3 TRCN0000135188 CAGCTTTACCTATGGTGCTTT pLKO.1 748 3UTR 100% 4.950 2.970 N OSTC n/a
4 TRCN0000135791 CCAATGATGTTGAGTGGCATT pLKO.1 553 3UTR 100% 4.050 2.430 N OSTC n/a
5 TRCN0000134376 GATGTTATTGTTGAACCTCCA pLKO.1 222 CDS 100% 2.160 1.080 Y OSTC n/a
6 TRCN0000146700 GATGTTATTGTTGAACCTCCA pLKO.1 222 CDS 100% 2.160 1.080 Y OSTCP1 n/a
7 TRCN0000128498 GCTCCTGTCAATGAAGTTTAA pLKO.1 360 3UTR 100% 13.200 6.600 Y OSTCP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001267817.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03865 pDONR223 100% 54.5% 53.6% None (many diffs) n/a
2 ccsbBroad304_03865 pLX_304 0% 54.5% 53.6% V5 (many diffs) n/a
3 TRCN0000466811 CACCATCTTCCTCTACTAGCAACA pLX_317 98.7% 54.5% 53.6% V5 (many diffs) n/a
4 ccsbBroadEn_10576 pDONR223 100% 31.6% 29.5% None (many diffs) n/a
5 ccsbBroad304_10576 pLX_304 0% 31.6% 29.5% V5 (many diffs) n/a
Download CSV