Transcript: Human NM_001270584.1

Homo sapiens IQ motif containing with AAA domain 1 (IQCA1), transcript variant 2, mRNA.

Source:
NCBI, updated 2018-06-25
Taxon:
Homo sapiens (human)
Gene:
IQCA1 (79781)
Length:
3155
CDS:
269..2614

Additional Resources:

NCBI RefSeq record:
NM_001270584.1
NBCI Gene record:
IQCA1 (79781)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001270584.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421758 ATTAGCCACCTTCTACGTAAA pLKO_005 391 CDS 100% 10.800 15.120 N IQCA1 n/a
2 TRCN0000418473 CCTCGGTGCTTTACTCGATAA pLKO_005 316 CDS 100% 10.800 15.120 N IQCA1 n/a
3 TRCN0000135715 GCTTTAATCCACGCCAAGTTT pLKO.1 2866 3UTR 100% 5.625 7.875 N IQCA1 n/a
4 TRCN0000138576 CCTTCGATGCTGAACTCCAAT pLKO.1 2196 CDS 100% 4.950 6.930 N IQCA1 n/a
5 TRCN0000135076 CCAAGGACATATAGTCGAAGT pLKO.1 2371 CDS 100% 4.050 5.670 N IQCA1 n/a
6 TRCN0000134914 CTCTAACATTGCTGGGAAATA pLKO.1 1948 CDS 100% 13.200 9.240 N IQCA1 n/a
7 TRCN0000430348 TTAGTAAGCAATGAGTATATC pLKO_005 3008 3UTR 100% 13.200 9.240 N IQCA1 n/a
8 TRCN0000427745 ATATTAGCGGACAGCGGAATA pLKO_005 689 CDS 100% 10.800 7.560 N IQCA1 n/a
9 TRCN0000135122 CCAGTGTACAAAGAGGAAGAA pLKO.1 2486 CDS 100% 4.950 3.465 N IQCA1 n/a
10 TRCN0000134193 CTTTAAGAACTGGTATGCCAA pLKO.1 2512 CDS 100% 2.640 1.584 N IQCA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001270584.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04124 pDONR223 100% 95% 95% None 1009_1010ins123 n/a
2 ccsbBroad304_04124 pLX_304 0% 95% 95% V5 1009_1010ins123 n/a
3 TRCN0000472214 TATATTGTAAGCCACCTATCACCT pLX_317 13.1% 95% 95% V5 1009_1010ins123 n/a
Download CSV