Transcript: Human NM_001271289.1

Homo sapiens zinc finger protein 512 (ZNF512), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-01-27
Taxon:
Homo sapiens (human)
Gene:
ZNF512 (84450)
Length:
3504
CDS:
362..1750

Additional Resources:

NCBI RefSeq record:
NM_001271289.1
NBCI Gene record:
ZNF512 (84450)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001271289.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000285459 TCCCTCTCAAGGCCAACTATA pLKO_005 1996 3UTR 100% 13.200 18.480 N ZNF512 n/a
2 TRCN0000275891 TTCGGGACCCACAACCTTTAA pLKO_005 163 5UTR 100% 13.200 10.560 N ZNF512 n/a
3 TRCN0000136276 GCTCCTCCAAATAGCTTTAAA pLKO.1 3106 3UTR 100% 15.000 10.500 N ZNF512 n/a
4 TRCN0000275892 GTACTTAGAAATCGTTGATAA pLKO_005 523 CDS 100% 13.200 9.240 N ZNF512 n/a
5 TRCN0000137601 CGTTCTGCCAAGATAGCTGTA pLKO.1 1067 CDS 100% 4.050 2.835 N ZNF512 n/a
6 TRCN0000285460 CGTTCTGCCAAGATAGCTGTA pLKO_005 1067 CDS 100% 4.050 2.835 N ZNF512 n/a
7 TRCN0000138063 GCTGAGTCTTAGAGTAGGGAA pLKO.1 1600 CDS 100% 2.640 1.848 N ZNF512 n/a
8 TRCN0000138036 GCTGCTACTTCTCATGTCGAA pLKO.1 386 CDS 100% 2.640 1.848 N ZNF512 n/a
9 TRCN0000135493 GTACCTGATGATCGAAAGTTA pLKO.1 1160 CDS 100% 0.000 0.000 N ZNF512 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001271289.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12820 pDONR223 100% 94.2% 94.2% None 141_142ins84 n/a
2 ccsbBroad304_12820 pLX_304 0% 94.2% 94.2% V5 141_142ins84 n/a
3 TRCN0000472898 ATGTCTGTTTATCCGTCTGGCGGC pLX_317 18.6% 94.2% 94.2% V5 141_142ins84 n/a
Download CSV