Transcript: Mouse NM_001271347.1

Mus musculus F-box and WD-40 domain protein 11 (Fbxw11), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Fbxw11 (103583)
Length:
4276
CDS:
337..1965

Additional Resources:

NCBI RefSeq record:
NM_001271347.1
NBCI Gene record:
Fbxw11 (103583)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001271347.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000012808 GCGCCTTGGTTTGGTACTAAA pLKO.1 2304 3UTR 100% 13.200 18.480 N Fbxw11 n/a
2 TRCN0000231306 GCGCCTTGGTTTGGTACTAAA pLKO_005 2304 3UTR 100% 13.200 18.480 N Fbxw11 n/a
3 TRCN0000231303 AGTATGATGAGCGAGTCATTG pLKO_005 1196 CDS 100% 10.800 15.120 N Fbxw11 n/a
4 TRCN0000231304 CCATCCGGTTATGGGATATTG pLKO_005 1607 CDS 100% 13.200 10.560 N Fbxw11 n/a
5 TRCN0000231302 CCATGTTGCAGCGGGACTTTA pLKO_005 674 CDS 100% 13.200 9.240 N Fbxw11 n/a
6 TRCN0000012810 GCTCCCATGATGACACTATTT pLKO.1 1859 CDS 100% 13.200 9.240 N Fbxw11 n/a
7 TRCN0000231305 GCTCCCATGATGACACTATTT pLKO_005 1859 CDS 100% 13.200 9.240 N Fbxw11 n/a
8 TRCN0000315280 GCTCCCATGATGACACTATTT pLKO_005 1859 CDS 100% 13.200 9.240 N FBXW11 n/a
9 TRCN0000012809 CCGGGACAACTCTATCAAGAT pLKO.1 1107 CDS 100% 4.950 3.465 N Fbxw11 n/a
10 TRCN0000012811 GCATGGACATATTAACTCTTA pLKO.1 645 CDS 100% 4.950 3.465 N Fbxw11 n/a
11 TRCN0000012812 GCTTTACCAGAGCAAGGCTTA pLKO.1 700 CDS 100% 4.050 2.835 N Fbxw11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001271347.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02746 pDONR223 100% 88% 92.4% None (many diffs) n/a
2 ccsbBroad304_02746 pLX_304 0% 88% 92.4% V5 (many diffs) n/a
3 TRCN0000481639 CACAACATGCATTGCGAAATGTCA pLX_317 29.6% 88% 92.4% V5 (many diffs) n/a
Download CSV