Construct: ORF TRCN0000481639
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF001267.2_s317c1
- Derived from:
- ccsbBroadEn_02746
- DNA Barcode:
- CACAACATGCATTGCGAAATGTCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- FBXW11 (23291)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000481639
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 23291 | FBXW11 | F-box and WD repeat domain ... | NM_033644.2 | 100% | 100% | |
| 2 | human | 23291 | FBXW11 | F-box and WD repeat domain ... | XM_005265856.2 | 98.1% | 97.3% | (many diffs) |
| 3 | human | 23291 | FBXW11 | F-box and WD repeat domain ... | XM_005265857.2 | 97.3% | 97.3% | 0_1ins42 |
| 4 | human | 23291 | FBXW11 | F-box and WD repeat domain ... | XM_005265858.3 | 96.4% | 96.4% | 0_1ins57 |
| 5 | human | 23291 | FBXW11 | F-box and WD repeat domain ... | XM_017009280.2 | 96.4% | 96.4% | 0_1ins57 |
| 6 | human | 23291 | FBXW11 | F-box and WD repeat domain ... | XM_017009279.1 | 96.2% | 95.2% | (many diffs) |
| 7 | human | 23291 | FBXW11 | F-box and WD repeat domain ... | NM_033645.2 | 96% | 96% | 44_45ins63 |
| 8 | human | 23291 | FBXW11 | F-box and WD repeat domain ... | NM_012300.2 | 95.6% | 92.7% | (many diffs) |
| 9 | human | 23291 | FBXW11 | F-box and WD repeat domain ... | XM_017009281.2 | 95.1% | 93.9% | (many diffs) |
| 10 | human | 23291 | FBXW11 | F-box and WD repeat domain ... | XM_005265855.5 | 93.9% | 93.9% | 45_146del |
| 11 | mouse | 103583 | Fbxw11 | F-box and WD-40 domain prot... | NM_001271348.1 | 91.9% | 99.2% | (many diffs) |
| 12 | mouse | 103583 | Fbxw11 | F-box and WD-40 domain prot... | XM_006514433.2 | 90.2% | 96.6% | (many diffs) |
| 13 | mouse | 103583 | Fbxw11 | F-box and WD-40 domain prot... | XM_006514434.3 | 88.4% | 95.6% | (many diffs) |
| 14 | mouse | 103583 | Fbxw11 | F-box and WD-40 domain prot... | NM_001271349.1 | 88.1% | 95.6% | (many diffs) |
| 15 | mouse | 103583 | Fbxw11 | F-box and WD-40 domain prot... | NM_001271347.1 | 88% | 92.4% | (many diffs) |
| 16 | mouse | 103583 | Fbxw11 | F-box and WD-40 domain prot... | XM_006514435.2 | 87.3% | 93.5% | (many diffs) |
| 17 | mouse | 103583 | Fbxw11 | F-box and WD-40 domain prot... | NM_134015.3 | 86.4% | 93.2% | (many diffs) |
| 18 | mouse | 103583 | Fbxw11 | F-box and WD-40 domain prot... | XM_006514436.3 | 77.1% | 83.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1653
- ORF length:
- 1587
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga gcccgactcg gtgattgagg acaagaccat cgagctcatg aacacttcag 121 ttatggaaga tcaaaatgaa gatgagtccc caaagaaaaa tactctttgg cagataagta 181 atggaacatc atctgtgatc gtctccagaa agaggccatc agaaggaaac tatcaaaaag 241 aaaaagactt gtgtattaaa tattttgacc agtggtctga atcagatcaa gtggaatttg 301 tggaacatct tatttcacga atgtgtcatt atcagcatgg acatattaac tcttacctga 361 agcccatgtt gcagcgggac tttattaccg ctttaccaga gcaaggctta gatcacatag 421 cagaaaacat tctttcgtac ctggatgcca ggtctctgtg tgcagcagag ctggtatgta 481 aagaatggca gcgagtgatc tcagaaggaa tgctttggaa gaagctgatt gaacgaatgg 541 tacgcactga tcccctatgg aaaggacttt cagaaagaag agggtgggat cagtacctgt 601 ttaaaaacag acccacagat ggccctccaa attcatttta taggtcatta tacccaaaga 661 ttatccagga tatagagact atagaatcta actggcggtg tggacgacac aacttgcaga 721 ggattcagtg ccgctctgaa aatagtaaag gtgtctactg tttacagtac gatgatgaaa 781 aaattatcag tggcctacga gataattcta ttaagatatg ggataaaacc agcctggaat 841 gtttgaaagt gttaacagga cacacaggct ctgtcctctg tctgcagtat gatgagcgtg 901 tcattgtaac tggctcttca gattctacgg tgagagtgtg ggatgtgaac acgggtgaag 961 ttcttaacac attgatccac cacaatgagg ctgtattgca cttacgcttc agcaatggac 1021 tgatggtgac ctgttccaag gaccgctcca ttgctgtgtg ggacatggct tctgcgaccg 1081 acatcacttt acgccgtgtc ctggttggcc accgggctgc cgtcaatgta gtagactttg 1141 acgacaagta catcgtgtct gcctctggtg acaggaccat caaagtcTGG AGCACGAGCA 1201 CCTGTGAATT TGTTCGTACT CTCAATGGGC ACAAGCGGGG CATTGCCTGT CTCCAGTACA 1261 GGGATCGCCT GGTTGTTAGT GGATCATCAG ATAATACCAT TAGGCTCTGG GATATTGAAT 1321 GTGGTGCCTG TTTAAGAGTC CTAGAGGGAC ATGAAGAATT GGTCCGATGC ATCCGGTTTG 1381 ATAACAAGAG GATTGTCAGT GGGGCCTATG ATGGGAAAAT TAAAGTTTGG GACTTGCAAG 1441 CTGCTCTTGA CCCTCGAGCC CCAGCAAGCA CATTGTGTTT GCGCACATTG GTGGAACATT 1501 CTGGACGTGT GTTTCGGCTC CAGTTTGATG AGTTTCAGAT CATCAGCAGC TCCCATGATG 1561 ACACTATTTT GATTTGGGAT TTCTTAAATG TGCCTCCCAG TGCCCAGAAT GAGACCCGTT 1621 CTCCCTCCAG AACATACACT TACATCTCTA GATACCCAAC TTTCTTGTAC AAAGTGGTTG 1681 ATATCGGTAA GCCTATCCCT AACCCTCTCC TCGGTCTCGA TTCTACGTAG TAATGAACTA 1741 GTCCGTAACT TGAAAGTATT TCGATTTCTT GGCTTTATAT ATCTTGTGGA AAGGACGACA 1801 CAACATGCAT TGCGAAATGT CAACGCGTTA AGTCgacaat caacctctgg attacaaaat 1861 ttgtgaaaga tt