Transcript: Mouse NM_001271730.1

Mus musculus X-box binding protein 1 (Xbp1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Xbp1 (22433)
Length:
2238
CDS:
355..1470

Additional Resources:

NCBI RefSeq record:
NM_001271730.1
NBCI Gene record:
Xbp1 (22433)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001271730.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232021 AGGCCTGTCTCTTTCGTTAAA pLKO_005 1529 3UTR 100% 13.200 18.480 N Xbp1 n/a
2 TRCN0000008419 CCCAGCTGATTAGTGTCTAAA pLKO.1 1451 CDS 100% 13.200 18.480 N Xbp1 n/a
3 TRCN0000008420 CCATTAATGAACTCATTCGTT pLKO.1 1085 CDS 100% 3.000 4.200 N Xbp1 n/a
4 TRCN0000232018 GGTTGAGAACCAGGAGTTAAG pLKO_005 714 CDS 100% 10.800 8.640 N Xbp1 n/a
5 TRCN0000232017 TGGAAGAAGAGAACCACAAAC pLKO_005 647 CDS 100% 10.800 7.560 N Xbp1 n/a
6 TRCN0000008423 TCTACCCAGAAGGACCTAGTT pLKO.1 1010 CDS 100% 4.950 3.465 N Xbp1 n/a
7 TRCN0000232020 TCTACCCAGAAGGACCTAGTT pLKO_005 1010 CDS 100% 4.950 3.465 N Xbp1 n/a
8 TRCN0000008421 CCAGGAGTTAAGAACACGCTT pLKO.1 723 CDS 100% 2.640 1.848 N Xbp1 n/a
9 TRCN0000008422 AGATAGAAAGAAAGCCCGGAT pLKO.1 597 CDS 100% 2.160 1.512 N Xbp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001271730.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13982 pDONR223 97.1% 55.1% 39% None (many diffs) n/a
2 ccsbBroad304_13982 pLX_304 0% 55.1% 39% V5 (many diffs) n/a
3 TRCN0000467935 GACGACACCCCTTCCACCAATGGT pLX_317 51.8% 55.1% 39% V5 (many diffs) n/a
Download CSV