Transcript: Human NM_001271736.2

Homo sapiens COPI coat complex subunit zeta 1 (COPZ1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
COPZ1 (22818)
Length:
1974
CDS:
94..651

Additional Resources:

NCBI RefSeq record:
NM_001271736.2
NBCI Gene record:
COPZ1 (22818)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001271736.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000065002 GCAGTATAGATCTCTATTTCT pLKO.1 329 CDS 100% 5.625 7.875 N COPZ1 n/a
2 TRCN0000298994 GCAGTATAGATCTCTATTTCT pLKO_005 329 CDS 100% 5.625 7.875 N COPZ1 n/a
3 TRCN0000380555 GTAGCTACACTTCAGATTAAA pLKO_005 972 3UTR 100% 15.000 12.000 N COPZ1 n/a
4 TRCN0000379566 GTAAAGCTCCCAGCATATTTA pLKO_005 853 3UTR 100% 15.000 10.500 N COPZ1 n/a
5 TRCN0000064998 CCATCGGACTGACAGTGAAAT pLKO.1 273 CDS 100% 13.200 9.240 N COPZ1 n/a
6 TRCN0000298990 CCATCGGACTGACAGTGAAAT pLKO_005 273 CDS 100% 13.200 9.240 N COPZ1 n/a
7 TRCN0000100681 GCCATCCTGATTCTGGACAAT pLKO.1 160 CDS 100% 4.950 3.465 N Copz1 n/a
8 TRCN0000363778 GCCATCCTGATTCTGGACAAT pLKO_005 160 CDS 100% 4.950 3.465 N Copz1 n/a
9 TRCN0000065001 GTCAGCCAAAGAACAGATCAA pLKO.1 612 CDS 100% 4.950 3.465 N COPZ1 n/a
10 TRCN0000298993 GTCAGCCAAAGAACAGATCAA pLKO_005 612 CDS 100% 4.950 3.465 N COPZ1 n/a
11 TRCN0000374707 AGCCAAAGAACAGATCAAGTG pLKO_005 615 CDS 100% 4.050 2.835 N Copz1 n/a
12 TRCN0000064999 CTTCGACTCATTGAGCCAGAT pLKO.1 408 CDS 100% 4.050 2.835 N COPZ1 n/a
13 TRCN0000299062 CTTCGACTCATTGAGCCAGAT pLKO_005 408 CDS 100% 4.050 2.835 N COPZ1 n/a
14 TRCN0000065000 CCTGTATACTGTCAAAGCCAT pLKO.1 144 CDS 100% 2.640 1.848 N COPZ1 n/a
15 TRCN0000298991 CCTGTATACTGTCAAAGCCAT pLKO_005 144 CDS 100% 2.640 1.848 N COPZ1 n/a
16 TRCN0000381033 TGCTCCCTTGCCCTGACATTT pLKO_005 928 3UTR 100% 13.200 7.920 N COPZ1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001271736.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02686 pDONR223 100% 95.1% 92.9% None (many diffs) n/a
2 ccsbBroad304_02686 pLX_304 0% 95.1% 92.9% V5 (many diffs) n/a
3 TRCN0000466412 AAACCCCAGAACTGAAAACCACAG pLX_317 74.5% 95.1% 92.9% V5 (many diffs) n/a
Download CSV