Transcript: Human NM_001276367.2

Homo sapiens chromosome 9 open reading frame 153 (C9orf153), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
C9orf153 (389766)
Length:
1924
CDS:
214..501

Additional Resources:

NCBI RefSeq record:
NM_001276367.2
NBCI Gene record:
C9orf153 (389766)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001276367.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263976 ATGTTCACTTCCAGAATTATA pLKO_005 273 CDS 100% 15.000 10.500 N C9orf153 n/a
2 TRCN0000282884 TTAATAAGGAGAGCAAGAAAT pLKO_005 311 CDS 100% 13.200 9.240 N C9orf153 n/a
3 TRCN0000263975 ATGCATGGTATTTCACTTAAC pLKO_005 346 CDS 100% 10.800 7.560 N C9orf153 n/a
4 TRCN0000167840 GAGAGCAAGAAATCAAATCTT pLKO.1 319 CDS 100% 5.625 3.938 N C9orf153 n/a
5 TRCN0000263977 ACGAAGCACAGGAAGTACTTG pLKO_005 365 CDS 100% 4.950 3.465 N C9orf153 n/a
6 TRCN0000167150 CTTCCAGAATTATATGCATGT pLKO.1 280 CDS 100% 4.050 2.835 N C9orf153 n/a
7 TRCN0000167665 GAGCAAGAAATCAAATCTTCT pLKO.1 321 CDS 100% 4.950 2.475 Y C9orf153 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001276367.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13661 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_13661 pLX_304 0% 100% 100% V5 (not translated due to frame shift) n/a
3 TRCN0000475974 TTAAAGTACGGATACTAATTGCTA pLX_317 100% 100% 100% V5 n/a
Download CSV