Transcript: Mouse NM_001277096.1

Mus musculus protein kinase inhibitor, gamma (Pkig), transcript variant 6, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Pkig (18769)
Length:
1050
CDS:
201..428

Additional Resources:

NCBI RefSeq record:
NM_001277096.1
NBCI Gene record:
Pkig (18769)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001277096.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000088603 GCACCATGAGATGTTATTTAT pLKO.1 618 3UTR 100% 15.000 10.500 N Pkig n/a
2 TRCN0000313290 AGCCGTTTAAAGCTCAGTTCT pLKO_005 872 3UTR 100% 4.950 3.465 N Pkig n/a
3 TRCN0000313289 GACACCAGCACCATGAGATGT pLKO_005 611 3UTR 100% 4.950 3.465 N Pkig n/a
4 TRCN0000088605 GCAGTGATGCGAACACCTCAT pLKO.1 403 CDS 100% 4.050 2.835 N Pkig n/a
5 TRCN0000312328 GCAGTGATGCGAACACCTCAT pLKO_005 403 CDS 100% 4.050 2.835 N Pkig n/a
6 TRCN0000088606 GCCTGAGAGCAGTGATGCGAA pLKO.1 395 CDS 100% 0.880 0.616 N Pkig n/a
7 TRCN0000088607 AGCCAGCCTGAGAGCAGTGAT pLKO.1 390 CDS 100% 1.650 0.990 N Pkig n/a
8 TRCN0000312327 AGCCAGCCTGAGAGCAGTGAT pLKO_005 390 CDS 100% 1.650 0.990 N Pkig n/a
9 TRCN0000088604 CTCGCACTTGAGGGAGCAGAA pLKO.1 333 CDS 100% 1.350 0.945 N Pkig n/a
10 TRCN0000349436 CTCGCACTTGAGGGAGCAGAA pLKO_005 333 CDS 100% 1.350 0.945 N Pkig n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001277096.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02626 pDONR223 100% 86.8% 89.4% None (many diffs) n/a
2 ccsbBroad304_02626 pLX_304 0% 86.8% 89.4% V5 (many diffs) n/a
3 TRCN0000468977 GTTCGTCTCCGAGGATAGTAATGT pLX_317 100% 86.8% 89.4% V5 (many diffs) n/a
Download CSV