Transcript: Mouse NM_001277219.1

Mus musculus v-crk avian sarcoma virus CT10 oncogene homolog (Crk), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Crk (12928)
Length:
5835
CDS:
166..780

Additional Resources:

NCBI RefSeq record:
NM_001277219.1
NBCI Gene record:
Crk (12928)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001277219.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000042603 CGAATAGGAGATCAAGAATTT pLKO.1 427 CDS 100% 13.200 18.480 N Crk n/a
2 TRCN0000042605 CATCCTGAGAATCCGGGATAA pLKO.1 636 CDS 100% 10.800 15.120 N Crk n/a
3 TRCN0000042604 GCTGGTAAAGGTTACGAAGAT pLKO.1 781 CDS 100% 4.950 6.930 N Crk n/a
4 TRCN0000021845 CGCCTCAGTATCGGCTCTGAT pLKO.1 747 CDS 100% 1.650 2.310 N CRK n/a
5 TRCN0000281380 CGCCTCAGTATCGGCTCTGAT pLKO_005 747 CDS 100% 1.650 2.310 N CRK n/a
6 TRCN0000321846 CTGTATGAGAAGACGTAAATA pLKO_005 1148 3UTR 100% 15.000 12.000 N Crk n/a
7 TRCN0000321842 TGGTAAAGGTTACGAAGATTA pLKO_005 783 3UTR 100% 13.200 9.240 N Crk n/a
8 TRCN0000321784 GAGGACTTCAGCTGAGTATAG pLKO_005 896 3UTR 100% 10.800 7.560 N Crk n/a
9 TRCN0000321844 TATTTGGACACTACAACATTG pLKO_005 487 CDS 100% 10.800 7.560 N Crk n/a
10 TRCN0000021848 CCTCTTTGACTTTAATGGGAA pLKO.1 582 CDS 100% 2.640 1.848 N CRK n/a
11 TRCN0000042606 CTGGATCAACAGAATCCCGAT pLKO.1 875 3UTR 100% 2.160 1.512 N Crk n/a
12 TRCN0000042607 GCCTGCTTTACTGGAATTCTA pLKO.1 456 CDS 100% 0.000 0.000 N Crk n/a
13 TRCN0000021846 GCTTTACTGGAATTCTACAAA pLKO.1 460 CDS 100% 0.000 0.000 N CRK n/a
14 TRCN0000281302 GCTTTACTGGAATTCTACAAA pLKO_005 460 CDS 100% 0.000 0.000 N CRK n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001277219.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15388 pDONR223 0% 94.6% 99.5% None (many diffs) n/a
2 ccsbBroadEn_06038 pDONR223 100% 63.4% 66.4% None (many diffs) n/a
3 ccsbBroad304_06038 pLX_304 0% 63.4% 66.4% V5 (many diffs) n/a
4 TRCN0000469357 TGTCATACTTCCAAGAGTACCAAC pLX_317 46% 63.4% 66.4% V5 (many diffs) n/a
Download CSV