Transcript: Human NM_001277226.2

Homo sapiens leucine rich repeat containing G protein-coupled receptor 5 (LGR5), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
LGR5 (8549)
Length:
4511
CDS:
284..2935

Additional Resources:

NCBI RefSeq record:
NM_001277226.2
NBCI Gene record:
LGR5 (8549)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001277226.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000357237 TATCAGTCCTGAAGTAATTAA pLKO_005 2596 CDS 100% 15.000 21.000 N LGR5 n/a
2 TRCN0000367755 TAGCCTCCGATCGCTGAATTT pLKO_005 1405 CDS 100% 13.200 18.480 N LGR5 n/a
3 TRCN0000364275 TTGGGACTGCTCTATGGTAAA pLKO_005 2488 CDS 100% 10.800 15.120 N LGR5 n/a
4 TRCN0000011587 CCGTCTGCAATCAGTTACCTA pLKO.1 1248 CDS 100% 3.000 2.400 N LGR5 n/a
5 TRCN0000364274 CCCAAGCTTGATGTCAATTAA pLKO_005 2749 CDS 100% 15.000 10.500 N LGR5 n/a
6 TRCN0000364345 GCCTAGAGACTTTAGATTTAA pLKO_005 987 CDS 100% 15.000 10.500 N LGR5 n/a
7 TRCN0000364343 TGAATGGTGCCTCACAAATAA pLKO_005 1146 CDS 100% 15.000 10.500 N LGR5 n/a
8 TRCN0000364272 ACCAGCTCCAGCATCACTTAT pLKO_005 2825 CDS 100% 13.200 9.240 N LGR5 n/a
9 TRCN0000357285 CTAGCCTGAAAGTAATCATTT pLKO_005 2247 CDS 100% 13.200 9.240 N LGR5 n/a
10 TRCN0000357236 GATCTGTCTTACAACCTATTA pLKO_005 1283 CDS 100% 13.200 9.240 N LGR5 n/a
11 TRCN0000364276 TTTCCAGAACTCAAGGTTATA pLKO_005 1604 CDS 100% 13.200 9.240 N LGR5 n/a
12 TRCN0000011586 CCATAGCAGTTCTGGCACTTA pLKO.1 1908 CDS 100% 4.950 3.465 N LGR5 n/a
13 TRCN0000011588 CTTACATTTATCAGTCCTGAA pLKO.1 2588 CDS 100% 4.050 2.835 N LGR5 n/a
14 TRCN0000011589 GCTCTACTGCAATTTGGACAA pLKO.1 2449 CDS 100% 4.050 2.835 N LGR5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001277226.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489128 CAATTAAATGCAATAACCTTCTTG pLX_317 12.9% 97.3% 97.3% V5 784_785ins72;810G>A n/a
2 TRCN0000489104 AGAATAAGACATAGAATAAACCCG pLX_317 13.7% 97.3% 97.3% V5 (not translated due to prior stop codon) 784_785ins72;810G>A n/a
3 ccsbBroadEn_07260 pDONR223 100% 97.2% 97.2% None 784_785ins72;810G>A;1925T>C n/a
4 ccsbBroad304_07260 pLX_304 0% 97.2% 97.2% V5 784_785ins72;810G>A;1925T>C n/a
5 TRCN0000474836 GATACCCGGCTGAAAGTCTCCACC pLX_317 18.3% 97.2% 97.2% V5 784_785ins72;810G>A;1925T>C n/a
Download CSV