Transcript: Mouse NM_001277256.1

Mus musculus sprouty protein with EVH-1 domain 1, related sequence (Spred1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Spred1 (114715)
Length:
2007
CDS:
655..1344

Additional Resources:

NCBI RefSeq record:
NM_001277256.1
NBCI Gene record:
Spred1 (114715)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001277256.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000066316 CCTTACAGAAGCTCAGACATA pLKO.1 1156 CDS 100% 4.950 3.465 N Spred1 n/a
2 TRCN0000312143 CCTTACAGAAGCTCAGACATA pLKO_005 1156 CDS 100% 4.950 3.465 N Spred1 n/a
3 TRCN0000066317 GTCCCTCATCAGGAAGAGAAT pLKO.1 793 CDS 100% 4.950 3.465 N Spred1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001277256.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09737 pDONR223 100% 45.1% 42% None (many diffs) n/a
2 ccsbBroad304_09737 pLX_304 0% 45.1% 42% V5 (many diffs) n/a
3 TRCN0000481551 CCATCTGTTACCGTGTTGTCGAAA pLX_317 33.7% 45.1% 42% V5 (many diffs) n/a
Download CSV