Transcript: Mouse NM_001278075.1

Mus musculus phenylalanyl-tRNA synthetase, beta subunit (Farsb), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Farsb (23874)
Length:
2091
CDS:
56..1825

Additional Resources:

NCBI RefSeq record:
NM_001278075.1
NBCI Gene record:
Farsb (23874)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001278075.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000076322 CCGATTATAAATGGGAATCAT pLKO.1 758 CDS 100% 5.625 7.875 N Farsb n/a
2 TRCN0000323973 CCGATTATAAATGGGAATCAT pLKO_005 758 CDS 100% 5.625 7.875 N Farsb n/a
3 TRCN0000076321 CCATTTACTTACACCGCGAAA pLKO.1 563 CDS 100% 4.050 5.670 N Farsb n/a
4 TRCN0000076320 CCCATTTACTTACACCGCGAA pLKO.1 562 CDS 100% 2.160 3.024 N Farsb n/a
5 TRCN0000323974 CCCATTTACTTACACCGCGAA pLKO_005 562 CDS 100% 2.160 3.024 N Farsb n/a
6 TRCN0000076319 GCAATCAGATTGAGGTTGAAA pLKO.1 1086 CDS 100% 5.625 3.938 N Farsb n/a
7 TRCN0000324037 GCAATCAGATTGAGGTTGAAA pLKO_005 1086 CDS 100% 5.625 3.938 N Farsb n/a
8 TRCN0000045895 GCTGGACAGAATTATGCAGTT pLKO.1 1597 CDS 100% 4.050 2.835 N FARSB n/a
9 TRCN0000286221 GCTGGACAGAATTATGCAGTT pLKO_005 1597 CDS 100% 4.050 2.835 N FARSB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001278075.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07541 pDONR223 100% 87.3% 93.7% None (many diffs) n/a
2 ccsbBroad304_07541 pLX_304 0% 87.3% 93.7% V5 (many diffs) n/a
3 TRCN0000480760 TCTAATCCCGCACTTGCATAGATT pLX_317 22.5% 87.3% 93.7% V5 (many diffs) n/a
Download CSV