Transcript: Human NM_001278417.2

Homo sapiens CD22 molecule (CD22), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
CD22 (933)
Length:
3099
CDS:
408..2435

Additional Resources:

NCBI RefSeq record:
NM_001278417.2
NBCI Gene record:
CD22 (933)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001278417.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430360 TGCGATGACACGGTCACTTAT pLKO_005 2259 CDS 100% 13.200 18.480 N CD22 n/a
2 TRCN0000057623 GCAGAATACATTCACGCTAAA pLKO.1 755 CDS 100% 10.800 15.120 N CD22 n/a
3 TRCN0000057627 CCTCGAAGTTTGATGGGACAA pLKO.1 207 5UTR 100% 4.050 5.670 N CD22 n/a
4 TRCN0000057625 CCAATCCTCTTCCAACAAATT pLKO.1 961 CDS 100% 13.200 9.240 N CD22 n/a
5 TRCN0000433392 GGGATCTGCTCGTCATCATTT pLKO_005 2780 3UTR 100% 13.200 9.240 N CD22 n/a
6 TRCN0000057624 CCTGGGATGCTACAATCCAAT pLKO.1 2135 CDS 100% 4.950 3.465 N CD22 n/a
7 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2557 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001278417.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10716 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_10716 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000491466 TTAGGCATCGGGTTCTGATAACTA pLX_317 12.6% 100% 100% V5 n/a
Download CSV