Transcript: Human NM_001278579.2

Homo sapiens activin A receptor type 2A (ACVR2A), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Homo sapiens (human)
Gene:
ACVR2A (92)
Length:
5359
CDS:
270..1811

Additional Resources:

NCBI RefSeq record:
NM_001278579.2
NBCI Gene record:
ACVR2A (92)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001278579.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244977 GGTATTAGAGGGTGCTATAAA pLKO_005 1376 CDS 100% 15.000 21.000 N ACVR2A n/a
2 TRCN0000244978 TAACCAGTGTTCGGCTTTATT pLKO_005 4496 3UTR 100% 15.000 21.000 N ACVR2A n/a
3 TRCN0000244975 CCCAGTTGCTTAACGAATATG pLKO_005 895 CDS 100% 13.200 18.480 N ACVR2A n/a
4 TRCN0000244976 GGCTAGAGGATTGGCATATTT pLKO_005 1157 CDS 100% 15.000 12.000 N ACVR2A n/a
5 TRCN0000244974 ACTGGTGTTGAACCGTGTTAT pLKO_005 402 CDS 100% 13.200 10.560 N ACVR2A n/a
6 TRCN0000022661 GCTAGAGGATTGGCATATTTA pLKO.1 1158 CDS 100% 15.000 10.500 N Acvr2a n/a
7 TRCN0000274494 GCTAGAGGATTGGCATATTTA pLKO_005 1158 CDS 100% 15.000 10.500 N Acvr2a n/a
8 TRCN0000000556 CAGGAAGTTGTTGTGCATAAA pLKO.1 1554 CDS 100% 13.200 9.240 N ACVR2A n/a
9 TRCN0000196571 GCTATGAGACTTGTAACTTTA pLKO.1 2942 3UTR 100% 13.200 9.240 N ACVR2A n/a
10 TRCN0000196507 GATGAATACATGTTGCCATTT pLKO.1 1494 CDS 100% 10.800 7.560 N ACVR2A n/a
11 TRCN0000194991 CCTTCTCCATTACTAGGTTTG pLKO.1 816 CDS 100% 6.000 4.200 N ACVR2A n/a
12 TRCN0000000553 CCAGATGCAGAGACTAACAAA pLKO.1 1709 CDS 100% 5.625 3.938 N ACVR2A n/a
13 TRCN0000194990 CGTGTTATGGTGACAAAGATA pLKO.1 415 CDS 100% 5.625 3.938 N ACVR2A n/a
14 TRCN0000022663 GAGGGCAATATGTGTAATGAA pLKO.1 585 CDS 100% 5.625 3.938 N Acvr2a n/a
15 TRCN0000022662 CCTCCCAAAGAATCTAGTCTA pLKO.1 1788 CDS 100% 4.950 3.465 N Acvr2a n/a
16 TRCN0000000552 CCTTAAATGAACTACTGCTAT pLKO.1 2166 3UTR 100% 4.950 3.465 N ACVR2A n/a
17 TRCN0000000555 CTATTACAACATCCTGCTCTA pLKO.1 674 CDS 100% 4.050 2.835 N ACVR2A n/a
18 TRCN0000000554 GCTAATGTGGTCTCTTGGAAT pLKO.1 1110 CDS 100% 4.950 2.970 N ACVR2A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001278579.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05768 pDONR223 100% 99.9% 100% None 354G>A n/a
2 ccsbBroad304_05768 pLX_304 0% 99.9% 100% V5 354G>A n/a
3 TRCN0000476792 GCATCAATGGAAATCAAAGACCTG pLX_317 33.3% 99.9% 100% V5 354G>A n/a
4 ccsbBroadEn_14529 pDONR223 0% 99.9% 100% None 354G>A n/a
5 ccsbBroad304_14529 pLX_304 0% 99.9% 100% V5 354G>A n/a
6 TRCN0000469988 CAAGCGACGGGCTTTCGGACTAAA pLX_317 25.7% 99.9% 100% V5 354G>A n/a
7 TRCN0000489398 TCACAGGTGCGAGCCCAGATTTCA pLX_317 21.5% 99.9% 100% V5 (not translated due to prior stop codon) 354G>A n/a
8 TRCN0000489291 AGTTCGTTACTAGGGTGTGACGGC pLX_317 23.3% 99.8% 100% V5 354G>A;1538_1539delTA n/a
Download CSV