Transcript: Human NM_001278616.1

Homo sapiens BUB1 mitotic checkpoint serine/threonine kinase (BUB1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Homo sapiens (human)
Gene:
BUB1 (699)
Length:
3576
CDS:
113..3310

Additional Resources:

NCBI RefSeq record:
NM_001278616.1
NBCI Gene record:
BUB1 (699)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001148548 GGTAGCAAAACAGTGTACCC pXPR_003 AGG 1840 58% 16 0.6809 BUB1 BUB1 76771
2 BRDN0001147751 CAAGGAGAAGCTTATTCGTG pXPR_003 GGG 670 21% 7 0.5565 BUB1 BUB1 76772
3 BRDN0001145062 TGATGAATCTTGGGTCATTG pXPR_003 TGG 131 4% 2 -0.4167 BUB1 BUB1 76770
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001278616.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000000800 CGAGGTTAATCCAGCACGTAT pLKO.1 1006 CDS 100% 4.950 6.930 N BUB1 n/a
2 TRCN0000010307 TACAACAGTGACCTCCATCAA pLKO.1 284 CDS 100% 4.950 6.930 N BUB1 n/a
3 TRCN0000295895 TACAACAGTGACCTCCATCAA pLKO_005 284 CDS 100% 4.950 6.930 N BUB1 n/a
4 TRCN0000196608 GAATTTCAATTGGGTTCTAAG pLKO.1 2387 CDS 100% 10.800 8.640 N BUB1 n/a
5 TRCN0000040157 CCTGGGTCAGAGTATAGATAT pLKO.1 2890 CDS 100% 13.200 9.240 N BUB1 n/a
6 TRCN0000288684 CCTGGGTCAGAGTATAGATAT pLKO_005 2890 CDS 100% 13.200 9.240 N BUB1 n/a
7 TRCN0000040154 GCAACAACAATACAGGTTATT pLKO.1 460 CDS 100% 13.200 9.240 N BUB1 n/a
8 TRCN0000288618 GCAACAACAATACAGGTTATT pLKO_005 460 CDS 100% 13.200 9.240 N BUB1 n/a
9 TRCN0000010549 GCTCCTACACTTCCTGATATT pLKO.1 1481 CDS 100% 13.200 9.240 N BUB1 n/a
10 TRCN0000000801 ACCAGTGAGTTCCTATCCAAA pLKO.1 2320 CDS 100% 4.950 3.465 N BUB1 n/a
11 TRCN0000295848 ACCAGTGAGTTCCTATCCAAA pLKO_005 2320 CDS 100% 4.950 3.465 N BUB1 n/a
12 TRCN0000010308 CATGGAACTACCAGATCGATT pLKO.1 2994 CDS 100% 4.950 3.465 N BUB1 n/a
13 TRCN0000307981 CATGGAACTACCAGATCGATT pLKO_005 2994 CDS 100% 4.950 3.465 N BUB1 n/a
14 TRCN0000195101 CCTGAGAATAAAGAATACTTG pLKO.1 167 CDS 100% 4.950 3.465 N BUB1 n/a
15 TRCN0000040155 CCTGATATTTCTGATGACAAA pLKO.1 1493 CDS 100% 4.950 3.465 N BUB1 n/a
16 TRCN0000010309 TAAATATGAATCTGCTCACTT pLKO.1 3346 3UTR 100% 4.950 3.465 N BUB1 n/a
17 TRCN0000000802 AGAAATACAATCAACGGAGAA pLKO.1 822 CDS 100% 4.050 2.835 N BUB1 n/a
18 TRCN0000040156 CCAAGCAGAATGGATGCAGAT pLKO.1 2206 CDS 100% 4.050 2.835 N BUB1 n/a
19 TRCN0000000799 CACTGTAAATATGAATCTGCT pLKO.1 3341 3UTR 100% 2.640 1.848 N BUB1 n/a
20 TRCN0000196292 GCATGAGCAATGGGTAAATGA pLKO.1 844 CDS 100% 5.625 3.375 N BUB1 n/a
21 TRCN0000040153 AAATATGAATCTGCTCACTTC pLKO.1 3347 3UTR 100% 4.950 3.465 N BUB1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001278616.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14555 pDONR223 0% 98.1% 98.1% None 26_27ins60 n/a
2 ccsbBroad304_14555 pLX_304 0% 98.1% 98.1% V5 26_27ins60 n/a
3 TRCN0000480863 TCACCCTAAAATTATGTTTGATGA pLX_317 12.9% 98.1% 98.1% V5 26_27ins60 n/a
4 TRCN0000489073 TCCAGCACATTACAGTTGTGTTCT pLX_317 9.8% 98.1% 98.1% V5 (not translated due to prior stop codon) 26_27ins60 n/a
5 TRCN0000489582 CATGTCCGGCCTTAAAGATGAAAA pLX_317 12.9% 98.1% 98% V5 26_27ins60;3195_3196insG n/a
Download CSV