Transcript: Human NM_001278698.2

Homo sapiens RNA polymerase II subunit H (POLR2H), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
POLR2H (5437)
Length:
946
CDS:
133..660

Additional Resources:

NCBI RefSeq record:
NM_001278698.2
NBCI Gene record:
POLR2H (5437)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001278698.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000053070 GCTAGTACCTTGTATGAAGAT pLKO.1 313 CDS 100% 4.950 6.930 N POLR2H n/a
2 TRCN0000286907 GCTAGTACCTTGTATGAAGAT pLKO_005 313 CDS 100% 4.950 6.930 N POLR2H n/a
3 TRCN0000294252 TCCACCGTGGCGGCATCTTTA pLKO_005 758 3UTR 100% 4.400 6.160 N POLR2H n/a
4 TRCN0000053068 GCATTGTGAGAGTGAATCTTT pLKO.1 216 CDS 100% 5.625 4.500 N POLR2H n/a
5 TRCN0000053069 CTGACCAGTTTGAGTATGTAA pLKO.1 386 CDS 100% 5.625 3.938 N POLR2H n/a
6 TRCN0000053072 CGACTGCATTGTGAGAGTGAA pLKO.1 211 CDS 100% 4.950 3.465 N POLR2H n/a
7 TRCN0000286908 CGACTGCATTGTGAGAGTGAA pLKO_005 211 CDS 100% 4.950 3.465 N POLR2H n/a
8 TRCN0000111333 TGAGAGTGAATCTTTCAAGAT pLKO.1 222 CDS 100% 4.950 3.465 N Polr2h n/a
9 TRCN0000332523 TGAGAGTGAATCTTTCAAGAT pLKO_005 222 CDS 100% 4.950 3.465 N Polr2h n/a
10 TRCN0000053071 CCTGATGAAGAAGCTAGCCTT pLKO.1 625 CDS 100% 2.640 1.848 N POLR2H n/a
11 TRCN0000294251 TACCCTGGATGATGGTGAATA pLKO_005 336 CDS 100% 0.000 0.000 N POLR2H n/a
12 TRCN0000111331 GCCAACAACCTGCATGGATTT pLKO.1 581 CDS 100% 10.800 7.560 N Polr2h n/a
13 TRCN0000332520 GCCAACAACCTGCATGGATTT pLKO_005 581 CDS 100% 10.800 7.560 N Polr2h n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001278698.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06750 pDONR223 98.7% 85.7% 69.6% None 336_399del;515_525del n/a
2 ccsbBroad304_06750 pLX_304 0% 85.7% 69.6% V5 (not translated due to prior stop codon) 336_399del;515_525del n/a
3 TRCN0000475146 ACAGAAAAAGGGAAGGGTGTATCC pLX_317 57.4% 85.7% 69.6% V5 (not translated due to prior stop codon) 336_399del;515_525del n/a
Download CSV