Transcript: Human NM_001281426.2

Homo sapiens dynactin subunit 3 (DCTN3), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
DCTN3 (11258)
Length:
859
CDS:
32..496

Additional Resources:

NCBI RefSeq record:
NM_001281426.2
NBCI Gene record:
DCTN3 (11258)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001281426.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000108246 TGATGCCTCTAAGCTGCAATT pLKO.1 268 CDS 100% 10.800 7.560 N DCTN3 n/a
2 TRCN0000300895 TGATGCCTCTAAGCTGCAATT pLKO_005 268 CDS 100% 10.800 7.560 N DCTN3 n/a
3 TRCN0000108245 CTTTGTTACAAGGCAGAGGAA pLKO.1 687 3UTR 100% 2.640 1.848 N DCTN3 n/a
4 TRCN0000300957 CTTTGTTACAAGGCAGAGGAA pLKO_005 687 3UTR 100% 2.640 1.848 N DCTN3 n/a
5 TRCN0000108248 GATCTGATCAAGTACCTGGAT pLKO.1 218 CDS 100% 2.640 1.848 N DCTN3 n/a
6 TRCN0000300896 GATCTGATCAAGTACCTGGAT pLKO_005 218 CDS 100% 2.640 1.848 N DCTN3 n/a
7 TRCN0000108249 CAATGCTTCTCTCCAAGCAAT pLKO.1 535 3UTR 100% 0.495 0.347 N DCTN3 n/a
8 TRCN0000300956 CAATGCTTCTCTCCAAGCAAT pLKO_005 535 3UTR 100% 0.495 0.347 N DCTN3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001281426.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02660 pDONR223 100% 87.5% 87.5% None 408_409ins66 n/a
2 ccsbBroad304_02660 pLX_304 0% 87.5% 87.5% V5 408_409ins66 n/a
3 TRCN0000478348 ACAAATTCCGAGATAGACGTCCAA pLX_317 60.7% 87.5% 87.5% V5 408_409ins66 n/a
Download CSV