Transcript: Mouse NM_001281859.1

Mus musculus cysteinyl leukotriene receptor 1 (Cysltr1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Cysltr1 (58861)
Length:
2960
CDS:
591..1649

Additional Resources:

NCBI RefSeq record:
NM_001281859.1
NBCI Gene record:
Cysltr1 (58861)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001281859.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000011327 CCTCTCCGTGTGGTCTATTAT pLKO.1 864 CDS 100% 15.000 21.000 N CYSLTR1 n/a
2 TRCN0000026402 CCTCTATTGTAGCATCTTCTT pLKO.1 953 CDS 100% 4.950 6.930 N Cysltr1 n/a
3 TRCN0000026332 GCTGCATCAAATTGTTGCTTT pLKO.1 1485 CDS 100% 4.950 3.960 N Cysltr1 n/a
4 TRCN0000356931 CTCTCCGTGTGGTCTATTATG pLKO_005 865 CDS 100% 13.200 9.240 N CYSLTR1 n/a
5 TRCN0000026346 CCACAGAACAATCAAGCTAAA pLKO.1 1164 CDS 100% 10.800 7.560 N Cysltr1 n/a
6 TRCN0000026374 GTGAGCTTCATGCCATATCAT pLKO.1 1365 CDS 100% 5.625 3.938 N Cysltr1 n/a
7 TRCN0000026400 AGAACATGAATGGAACTGAAA pLKO.1 625 CDS 100% 4.950 3.465 N Cysltr1 n/a
8 TRCN0000356933 TCTGTTACACAATGATCATTT pLKO_005 1255 CDS 100% 13.200 18.480 N CYSLTR1 n/a
9 TRCN0000011324 CCTGTGATTCTGTCCTTAGAA pLKO.1 1432 CDS 100% 5.625 3.938 N CYSLTR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001281859.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489453 TGTAAGTCCAGCGACTTTAGCCAG pLX_317 36.8% 83.9% 83.8% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_14056 pDONR223 100% 83.9% 55.2% None (many diffs) n/a
3 ccsbBroad304_14056 pLX_304 0% 83.9% 55.2% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000473521 GATCGCTATGAACCGCGTCGTGTC pLX_317 24.5% 83.9% 55.2% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000488603 CTCTCGACTTAGGGCTCGCACGCC pLX_317 36.7% 83.9% 83.5% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000488619 TCCCGTAAGGTTCTACCTGAAGAG pLX_317 33.8% 83.8% 83.5% V5 (many diffs) n/a
Download CSV