Transcript: Mouse NM_001282045.1

Mus musculus schwannomin interacting protein 1 (Schip1), transcript variant 6, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Schip1 (30953)
Length:
2060
CDS:
66..1436

Additional Resources:

NCBI RefSeq record:
NM_001282045.1
NBCI Gene record:
Schip1 (30953)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001282045.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000306696 ACGATGGCCCAGGAATCTATA pLKO_005 790 CDS 100% 13.200 6.600 Y Schip1 n/a
2 TRCN0000106560 CCAGAGAACAAGCTAGAATTT pLKO.1 1451 3UTR 100% 13.200 6.600 Y Schip1 n/a
3 TRCN0000327417 CCAGAGAACAAGCTAGAATTT pLKO_005 1451 3UTR 100% 13.200 6.600 Y Schip1 n/a
4 TRCN0000306634 TGGTCCAGCTGCTCCTTATTC pLKO_005 1306 CDS 100% 13.200 6.600 Y Schip1 n/a
5 TRCN0000306635 AGCGATGCAGATGACAGTAAG pLKO_005 912 CDS 100% 10.800 5.400 Y Schip1 n/a
6 TRCN0000106561 GCCTCACATAAGCGAATGTTT pLKO.1 1178 CDS 100% 5.625 2.813 Y Schip1 n/a
7 TRCN0000106562 TGCCTCACATAAGCGAATGTT pLKO.1 1177 CDS 100% 5.625 2.813 Y Schip1 n/a
8 TRCN0000327344 TGCCTCACATAAGCGAATGTT pLKO_005 1177 CDS 100% 5.625 2.813 Y Schip1 n/a
9 TRCN0000106563 GCAGCTACAAGTGATCGTCAA pLKO.1 1247 CDS 100% 4.050 2.025 Y Schip1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001282045.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08154 pDONR223 100% 48.3% 51.3% None (many diffs) n/a
2 ccsbBroad304_08154 pLX_304 0% 48.3% 51.3% V5 (many diffs) n/a
3 TRCN0000472729 TACGAATTGCCGAAGCTCGATTAC pLX_317 56.6% 48.3% 51.3% V5 (many diffs) n/a
Download CSV