Transcript: Human NM_001282117.1

Homo sapiens regulatory factor X3 (RFX3), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
RFX3 (5991)
Length:
1543
CDS:
248..1489

Additional Resources:

NCBI RefSeq record:
NM_001282117.1
NBCI Gene record:
RFX3 (5991)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001282117.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000014874 CCGAACAACAACGTATCCTTA pLKO.1 463 CDS 100% 4.950 6.930 N RFX3 n/a
2 TRCN0000014877 GCGACAATTGAAATGGCGATT pLKO.1 716 CDS 100% 4.050 5.670 N RFX3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001282117.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11098 pDONR223 100% 99.8% 99.7% None 929A>G;1011A>G n/a
2 ccsbBroad304_11098 pLX_304 0% 99.8% 99.7% V5 929A>G;1011A>G n/a
3 TRCN0000481511 AACTACTTAATTAAATATAGCAAC pLX_317 36.4% 99.8% 99.7% V5 929A>G;1011A>G n/a
4 ccsbBroadEn_01393 pDONR223 100% 54.6% 53.1% None (many diffs) n/a
5 ccsbBroad304_01393 pLX_304 0% 54.6% 53.1% V5 (many diffs) n/a
Download CSV