Transcript: Human NM_001282403.2

Homo sapiens malate dehydrogenase 2 (MDH2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
MDH2 (4191)
Length:
2044
CDS:
56..946

Additional Resources:

NCBI RefSeq record:
NM_001282403.2
NBCI Gene record:
MDH2 (4191)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001282403.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000221882 GAAGCCATGATCTGCGTCATT pLKO.1 455 CDS 100% 4.950 3.960 N MDH2 n/a
2 TRCN0000297184 GAAGCCATGATCTGCGTCATT pLKO_005 455 CDS 100% 4.950 3.960 N MDH2 n/a
3 TRCN0000221885 AGGAAGGTGTTGTGGAATGTT pLKO.1 735 CDS 100% 5.625 3.938 N MDH2 n/a
4 TRCN0000278346 AGGAAGGTGTTGTGGAATGTT pLKO_005 735 CDS 100% 5.625 3.938 N MDH2 n/a
5 TRCN0000221881 GCCCAGAACAATGCTAAAGTA pLKO.1 116 CDS 100% 5.625 3.938 N MDH2 n/a
6 TRCN0000278345 GCCCAGAACAATGCTAAAGTA pLKO_005 116 CDS 100% 5.625 3.938 N MDH2 n/a
7 TRCN0000221884 GACGACCTGTTCAACACCAAT pLKO.1 386 CDS 100% 4.950 3.465 N MDH2 n/a
8 TRCN0000278262 GACGACCTGTTCAACACCAAT pLKO_005 386 CDS 100% 4.950 3.465 N MDH2 n/a
9 TRCN0000221883 GAAGATGATCTCGGATGCCAT pLKO.1 868 CDS 100% 2.640 1.848 N MDH2 n/a
10 TRCN0000278344 GAAGATGATCTCGGATGCCAT pLKO_005 868 CDS 100% 2.640 1.848 N MDH2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001282403.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06574 pDONR223 100% 87.4% 87.2% None 26C>T;428_429ins126 n/a
2 ccsbBroad304_06574 pLX_304 0% 87.4% 87.2% V5 26C>T;428_429ins126 n/a
3 TRCN0000492023 CGCAAGAGCACAAGGGTCTTCCGC pLX_317 38.2% 87.4% 87.2% V5 26C>T;428_429ins126 n/a
Download CSV