Transcript: Human NM_001282518.2

Homo sapiens ZFP37 zinc finger protein (ZFP37), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
ZFP37 (7539)
Length:
6280
CDS:
37..1932

Additional Resources:

NCBI RefSeq record:
NM_001282518.2
NBCI Gene record:
ZFP37 (7539)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001282518.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000020172 GCTCAGAGCAACCTGTATAAT pLKO.1 193 CDS 100% 15.000 10.500 N ZFP37 n/a
2 TRCN0000415071 GAAAGGTTCTCAGCCATAAAC pLKO_005 935 CDS 100% 13.200 9.240 N ZFP37 n/a
3 TRCN0000436611 GCAATGGAGAAACAAGTTATA pLKO_005 2223 3UTR 100% 13.200 9.240 N ZFP37 n/a
4 TRCN0000433971 TGGATGGAAACAAGGGTTTAA pLKO_005 2083 3UTR 100% 13.200 9.240 N ZFP37 n/a
5 TRCN0000020173 GCTCATCTACTAAGCATGAAA pLKO.1 872 CDS 100% 5.625 3.938 N ZFP37 n/a
6 TRCN0000020169 GCCATCTGTATAAGCCTCTTT pLKO.1 2344 3UTR 100% 4.950 3.465 N ZFP37 n/a
7 TRCN0000020170 GCTGTCATAGTTCATCCCATA pLKO.1 797 CDS 100% 4.050 2.835 N ZFP37 n/a
8 TRCN0000434937 GTCATTCAACCATAGCTTATC pLKO_005 669 CDS 100% 10.800 6.480 N ZFP37 n/a
9 TRCN0000020171 GCTCATCTCTTACTTACCATA pLKO.1 1541 CDS 100% 4.950 2.970 N ZFP37 n/a
10 TRCN0000148104 GAGTGTAATGAATGTGGGAAA pLKO.1 1675 CDS 100% 4.050 2.025 Y ZNF658B n/a
11 TRCN0000172660 GTCTCAAACTTCTGGGCTCAA pLKO.1 6072 3UTR 100% 4.050 2.025 Y RHPN1-AS1 n/a
12 TRCN0000017939 CCTTACTCAACATCAGAGAAT pLKO.1 1632 CDS 100% 4.950 2.475 Y ZNF519 n/a
13 TRCN0000148848 CATACAGGTGAGAAACCCTAT pLKO.1 1402 CDS 100% 4.050 2.025 Y ZNF260 n/a
14 TRCN0000147970 GAATGTAAGGAATGTGGGAAA pLKO.1 1255 CDS 100% 4.050 2.025 Y ZNF700 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001282518.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07144 pDONR223 100% 99.7% 99.6% None 20T>A;132_134delGAA n/a
2 ccsbBroad304_07144 pLX_304 0% 99.7% 99.6% V5 20T>A;132_134delGAA n/a
3 TRCN0000479723 TATTCTTAATTTGATCACAACCGA pLX_317 16.1% 99.7% 99.6% V5 20T>A;132_134delGAA n/a
Download CSV