Transcript: Human NM_001282527.1

Homo sapiens nucleolar protein 4 (NOL4), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
NOL4 (8715)
Length:
3706
CDS:
694..1953

Additional Resources:

NCBI RefSeq record:
NM_001282527.1
NBCI Gene record:
NOL4 (8715)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001282527.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413440 ACCATGACGATTCGGAGAAAG pLKO_005 1397 CDS 100% 10.800 8.640 N NOL4 n/a
2 TRCN0000146905 CCAGATGGAACAGATCATAAA pLKO.1 733 CDS 100% 13.200 9.240 N NOL4 n/a
3 TRCN0000147737 CCATATTCACTGAGGTCTAAA pLKO.1 1966 3UTR 100% 13.200 9.240 N NOL4 n/a
4 TRCN0000147530 GATCCGTAAGTGATGTGTTAA pLKO.1 2091 3UTR 100% 13.200 9.240 N NOL4 n/a
5 TRCN0000130265 CTTTAGTATGTCCAGCCTATT pLKO.1 2153 3UTR 100% 10.800 7.560 N NOL4 n/a
6 TRCN0000129026 GCTCCAATCTTGAAGAAAGAA pLKO.1 944 CDS 100% 5.625 3.938 N NOL4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001282527.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11297 pDONR223 100% 82.8% 82.8% None 0_1ins123;772_885del n/a
2 ccsbBroad304_11297 pLX_304 0% 82.8% 82.8% V5 0_1ins123;772_885del n/a
3 TRCN0000474534 TAATTCATAGTAGGTCAAAAGAAC pLX_317 41.4% 82.8% 82.8% V5 0_1ins123;772_885del n/a
Download CSV