Transcript: Human NM_001282563.2

Homo sapiens dopamine receptor D3 (DRD3), transcript variant f, mRNA.

Source:
NCBI, updated 2019-08-21
Taxon:
Homo sapiens (human)
Gene:
DRD3 (1814)
Length:
1557
CDS:
291..1493

Additional Resources:

NCBI RefSeq record:
NM_001282563.2
NBCI Gene record:
DRD3 (1814)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001282563.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000221110 GCAATGGCAGATTATCGACAT pLKO.1 1195 CDS 100% 4.050 3.240 N DRD3 n/a
2 TRCN0000221109 CCTCTTCTGTTTGGCTTTAAT pLKO.1 789 CDS 100% 15.000 10.500 N DRD3 n/a
3 TRCN0000440828 ACAGGTGGAGTCTGGAATTTC pLKO_005 564 CDS 100% 13.200 9.240 N Drd3 n/a
4 TRCN0000356875 TGTACAGCCAGCATCCTTAAT pLKO_005 630 CDS 100% 13.200 9.240 N DRD3 n/a
5 TRCN0000356939 GAGTGACTGTCCTTGTCTATG pLKO_005 895 CDS 100% 10.800 7.560 N DRD3 n/a
6 TRCN0000221108 CCTTGTCTATGCCAGAATCTA pLKO.1 905 CDS 100% 5.625 3.938 N DRD3 n/a
7 TRCN0000221107 CCCTTCTTCTTGACCCATGTT pLKO.1 1320 CDS 100% 4.950 3.465 N DRD3 n/a
8 TRCN0000011345 GTCTGGAATTTCAGCCGCATT pLKO.1 573 CDS 100% 4.050 2.835 N DRD3 n/a
9 TRCN0000356876 AGACTACCACCAACTACTTAG pLKO_005 472 CDS 100% 10.800 6.480 N DRD3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001282563.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488434 ACTTCACCCGGCAGTGTAAATTTG pLX_317 29.1% 99.8% 99.7% V5 (not translated due to prior stop codon) 15C>T;25G>A n/a
2 TRCN0000491549 AAACCACCCTGCTGTGAGTCTTTG pLX_317 25.8% 99.7% 99.5% V5 15C>T;25G>A;1200_1201insG n/a
3 ccsbBroadEn_06121 pDONR223 100% 99.6% 99% None (many diffs) n/a
4 ccsbBroad304_06121 pLX_304 0% 99.6% 99% V5 (many diffs) n/a
5 TRCN0000476045 TCCGATGTCGAATGTTTCCGGTAT pLX_317 27% 99.6% 99% V5 (many diffs) n/a
Download CSV