Transcript: Human NM_001282935.1

Homo sapiens zinc finger protein 341 (ZNF341), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-04-09
Taxon:
Homo sapiens (human)
Gene:
ZNF341 (84905)
Length:
3398
CDS:
336..2630

Additional Resources:

NCBI RefSeq record:
NM_001282935.1
NBCI Gene record:
ZNF341 (84905)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001282935.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000233221 TGAAGACCCGACGAGCTAAAG pLKO_005 961 CDS 100% 10.800 15.120 N ZNF341 n/a
2 TRCN0000150341 CCATAAACTCTTCGGAGTTTA pLKO.1 3033 3UTR 100% 1.320 1.848 N ZNF341 n/a
3 TRCN0000152506 GCCATAAACTCTTCGGAGTTT pLKO.1 3032 3UTR 100% 0.495 0.693 N ZNF341 n/a
4 TRCN0000233224 CATCGAGCCATTGGCAGAAAT pLKO_005 2729 3UTR 100% 13.200 9.240 N ZNF341 n/a
5 TRCN0000233223 CCGTCTACAAGTGTGTCAAAT pLKO_005 1678 CDS 100% 13.200 9.240 N ZNF341 n/a
6 TRCN0000233220 GTGTGGAGCCTCCAGTATATC pLKO_005 820 CDS 100% 13.200 9.240 N ZNF341 n/a
7 TRCN0000233222 TTCCCAAAGCTCGACACATTT pLKO_005 1515 CDS 100% 13.200 9.240 N ZNF341 n/a
8 TRCN0000155623 CCTGGCAAACAGGGATTCAAA pLKO.1 861 CDS 100% 5.625 3.938 N ZNF341 n/a
9 TRCN0000155740 CAAGAAGGACAATGCCGTCTA pLKO.1 1664 CDS 100% 4.050 2.430 N ZNF341 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001282935.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12880 pDONR223 100% 89.4% 86.6% None 0_1ins73;68_69ins197;2235T>C n/a
2 ccsbBroad304_12880 pLX_304 0% 89.4% 86.6% V5 0_1ins73;68_69ins197;2235T>C n/a
3 TRCN0000471153 TTCCAGGATAGGGGCGCACGCTCC pLX_317 18.6% 89.4% 86.6% V5 0_1ins73;68_69ins197;2235T>C n/a
4 ccsbBroadEn_04444 pDONR223 100% 88.6% 85.7% None 0_1ins73;68_69ins197;644_664del n/a
5 ccsbBroad304_04444 pLX_304 0% 88.6% 85.7% V5 0_1ins73;68_69ins197;644_664del n/a
6 TRCN0000474267 CAACGTCACTCACGCCATCTTTTC pLX_317 8.8% 88.6% 85.7% V5 0_1ins73;68_69ins197;644_664del n/a
Download CSV