Transcript: Human NM_001282936.1

Homo sapiens STIL centriolar assembly protein (STIL), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
STIL (6491)
Length:
5225
CDS:
365..4228

Additional Resources:

NCBI RefSeq record:
NM_001282936.1
NBCI Gene record:
STIL (6491)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001282936.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434653 TCAAGTTCAAGGGACTTATAA pLKO_005 1039 CDS 100% 15.000 12.000 N STIL n/a
2 TRCN0000428252 ATGGATGAAACACGCAAATTG pLKO_005 1076 CDS 100% 13.200 10.560 N STIL n/a
3 TRCN0000417269 GAGATATGGACTCCTACAAAG pLKO_005 3736 CDS 100% 10.800 8.640 N STIL n/a
4 TRCN0000416959 ATTCAGCCTTCTCCATATTAA pLKO_005 3640 CDS 100% 15.000 10.500 N STIL n/a
5 TRCN0000423565 CAGATAGCAAGAGTGAATATT pLKO_005 3798 CDS 100% 15.000 10.500 N STIL n/a
6 TRCN0000198100 CGTCATGCTAAGCAGAATAAA pLKO.1 563 CDS 100% 15.000 10.500 N Stil n/a
7 TRCN0000426925 GCAACCTTCTGAAACGCTAAA pLKO_005 4132 CDS 100% 10.800 7.560 N STIL n/a
8 TRCN0000003970 GTCTGGAATTACACATATCTA pLKO.1 1156 CDS 100% 5.625 3.938 N STIL n/a
9 TRCN0000003966 GATCAGTTATTCCTACAAGTT pLKO.1 4458 3UTR 100% 4.950 3.465 N STIL n/a
10 TRCN0000003968 TGGATTAAACTGCATGTCATT pLKO.1 3478 CDS 100% 4.950 3.465 N STIL n/a
11 TRCN0000003969 CCAGGAACAGTATTAAACCAT pLKO.1 1917 CDS 100% 3.000 2.100 N STIL n/a
12 TRCN0000003967 CCTTTGATTAACCACTTGGAA pLKO.1 1724 CDS 100% 3.000 2.100 N STIL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001282936.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.