Transcript: Human NM_001284274.2

Homo sapiens HECT domain E3 ubiquitin protein ligase 2 (HECTD2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-02-25
Taxon:
Homo sapiens (human)
Gene:
HECTD2 (143279)
Length:
4959
CDS:
155..2497

Additional Resources:

NCBI RefSeq record:
NM_001284274.2
NBCI Gene record:
HECTD2 (143279)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001284274.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000412949 GTCAGTACCCATTCGTTATTT pLKO_005 1272 CDS 100% 15.000 21.000 N Hectd2 n/a
2 TRCN0000432306 AGTTAAGTCATCAGGAGATTG pLKO_005 577 CDS 100% 10.800 15.120 N HECTD2 n/a
3 TRCN0000417675 TTATCTAACAACGTTTGATTC pLKO_005 616 CDS 100% 10.800 8.640 N HECTD2 n/a
4 TRCN0000419398 ACCAATTTGCCTTGATGTTAG pLKO_005 436 CDS 100% 10.800 7.560 N HECTD2 n/a
5 TRCN0000429438 CAGTCCTTCCAGAACCTATTC pLKO_005 507 CDS 100% 10.800 7.560 N HECTD2 n/a
6 TRCN0000430786 CCATTGAAGACTCTGGGATTA pLKO_005 690 CDS 100% 10.800 7.560 N HECTD2 n/a
7 TRCN0000420007 GATGCATCATCATCCGAAATG pLKO_005 479 CDS 100% 10.800 7.560 N HECTD2 n/a
8 TRCN0000007762 GCCTCATTTAACACCATTGAA pLKO.1 677 CDS 100% 5.625 3.938 N HECTD2 n/a
9 TRCN0000007759 GCTGTGTATGATACCTTACTT pLKO.1 728 CDS 100% 5.625 3.938 N HECTD2 n/a
10 TRCN0000007760 CCCAGAATTAAATGCTGCATT pLKO.1 640 CDS 100% 4.950 3.465 N HECTD2 n/a
11 TRCN0000007761 CGAAGAAAGAAGCTGCTGAAA pLKO.1 357 CDS 100% 4.950 3.465 N HECTD2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001284274.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491311 AGACCCACCAAAACAATGAAACTA pLX_317 9.4% 99.4% 99.4% V5 (not translated due to prior stop codon) 822_833del n/a
2 TRCN0000488652 GGGGAAACATCGGCAACATGCCAC pLX_317 14.4% 99.4% 99.3% V5 822_833del;2340_2341insG n/a
Download CSV