Transcript: Mouse NM_001284392.1

Mus musculus septin 4 (Sept4), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Mus musculus (mouse)
Gene:
Sept4 (18952)
Length:
1426
CDS:
106..1245

Additional Resources:

NCBI RefSeq record:
NM_001284392.1
NBCI Gene record:
Sept4 (18952)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001284392.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416344 GAGAATCTGGTCTGGGTAAAT pLKO_005 260 CDS 100% 13.200 18.480 N Sept4 n/a
2 TRCN0000441026 AGGAACGGAATCGCAACAAAC pLKO_005 1070 CDS 100% 10.800 15.120 N Sept4 n/a
3 TRCN0000433206 TGCATCAGCGGGTCAACATTG pLKO_005 641 CDS 100% 10.800 15.120 N Sept4 n/a
4 TRCN0000101737 CCGGCCATTGGATGTTGAATT pLKO.1 609 CDS 100% 0.000 0.000 N Sept4 n/a
5 TRCN0000101736 CCTAAAGGAAAGCATCCCATT pLKO.1 819 CDS 100% 4.050 2.835 N Sept4 n/a
6 TRCN0000160749 CCTAAAGGAAAGCATCCCATT pLKO.1 819 CDS 100% 4.050 2.835 N SEPTIN4 n/a
7 TRCN0000101739 AGAGTGGTACTGACTTCCCTA pLKO.1 1100 CDS 100% 2.640 1.848 N Sept4 n/a
8 TRCN0000164795 CCCTAAAGGAAAGCATCCCAT pLKO.1 818 CDS 100% 2.640 1.848 N SEPTIN4 n/a
9 TRCN0000101735 TAAATCTCTTCTTCCTGCCTA pLKO.1 1268 3UTR 100% 2.640 1.848 N Sept4 n/a
10 TRCN0000155973 CCAGCAGTTTGAGCAGTACTT pLKO.1 498 CDS 100% 4.950 2.970 N SEPTIN5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001284392.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01233 pDONR223 100% 72.4% 77.8% None (many diffs) n/a
2 ccsbBroad304_01233 pLX_304 0% 72.4% 77.8% V5 (many diffs) n/a
3 TRCN0000481592 ATGCAACTCATTTCAGGTCCTCCG pLX_317 29.2% 65.3% 64.3% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000476347 CCATTTCCAACTATGATTTCGGGC pLX_317 25.8% 65.3% 64.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV