Transcript: Human NM_001284415.2

Homo sapiens 2-hydroxyacyl-CoA lyase 1 (HACL1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
HACL1 (26061)
Length:
1829
CDS:
107..1663

Additional Resources:

NCBI RefSeq record:
NM_001284415.2
NBCI Gene record:
HACL1 (26061)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001284415.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000078295 GCGGCTTCTGTTATTAGGAAT pLKO.1 644 CDS 100% 4.950 3.960 N HACL1 n/a
2 TRCN0000078296 CAATGGAATTTACCAAGGTTT pLKO.1 1372 CDS 100% 4.950 3.465 N HACL1 n/a
3 TRCN0000078297 CCTCCAAGATATCAGCCAGAT pLKO.1 902 CDS 100% 4.050 2.835 N HACL1 n/a
4 TRCN0000078293 CCGCTGTTACTTTGCTAGGAA pLKO.1 978 CDS 100% 3.000 2.100 N HACL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001284415.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02909 pDONR223 100% 89.6% 89.6% None 379_380ins78;913_914ins102 n/a
2 ccsbBroad304_02909 pLX_304 0% 89.6% 89.6% V5 379_380ins78;913_914ins102 n/a
3 TRCN0000471578 AAGCTCCCGCCGAATCAGTCTAAG pLX_317 18.3% 89.6% 89.6% V5 379_380ins78;913_914ins102 n/a
4 ccsbBroadEn_11805 pDONR223 100% 22% 20.5% None (many diffs) n/a
5 TRCN0000465527 ACCATTAGCTTTGGCCTCTAATAT pLX_317 71.3% 22% 20.5% V5 (many diffs) n/a
Download CSV