Transcript: Human NM_001284424.2

Homo sapiens myosin VIIA and Rab interacting protein (MYRIP), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
MYRIP (25924)
Length:
4878
CDS:
339..2723

Additional Resources:

NCBI RefSeq record:
NM_001284424.2
NBCI Gene record:
MYRIP (25924)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001284424.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432602 CAGATATTGAGAGCCGGATTT pLKO_005 2410 CDS 100% 10.800 15.120 N MYRIP n/a
2 TRCN0000117043 CCCAGGTACAAACCATAGATA pLKO.1 2506 CDS 100% 5.625 4.500 N MYRIP n/a
3 TRCN0000415573 ATCTTCAGTGACTACCATTAA pLKO_005 2588 CDS 100% 13.200 9.240 N MYRIP n/a
4 TRCN0000117042 GCCAAATAAGTGCAAAGATTT pLKO.1 4596 3UTR 100% 13.200 9.240 N MYRIP n/a
5 TRCN0000430864 TAGTATTCCATGTCAACAATT pLKO_005 3075 3UTR 100% 13.200 9.240 N MYRIP n/a
6 TRCN0000117045 GCTGTACGAGTTAGCAATGAA pLKO.1 2096 CDS 100% 5.625 3.938 N MYRIP n/a
7 TRCN0000117046 CCTGCAGAAGATTATACGAAA pLKO.1 1058 CDS 100% 4.950 3.465 N MYRIP n/a
8 TRCN0000091475 AGAGACTTCAATCTTCGCAAA pLKO.1 408 CDS 100% 4.050 2.835 N Myrip n/a
9 TRCN0000117044 GCTTCGACATTCTAGGAGGAA pLKO.1 793 CDS 100% 2.640 1.848 N MYRIP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001284424.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15029 pDONR223 79.9% 81.8% 74.9% None (many diffs) n/a
2 ccsbBroad304_15029 pLX_304 0% 81.8% 74.9% V5 (many diffs) n/a
3 TRCN0000476520 ATCACTACACCCGGTGAGACATCC pLX_317 19.5% 81.8% 74.9% V5 (many diffs) n/a
Download CSV