Transcript: Mouse NM_001285434.1

Mus musculus eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein) (Eef1d), transcript variant 8, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Eef1d (66656)
Length:
1692
CDS:
105..935

Additional Resources:

NCBI RefSeq record:
NM_001285434.1
NBCI Gene record:
Eef1d (66656)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001285434.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000054668 GCGAACATCTAAGTTGAGAAA pLKO.1 1322 3UTR 100% 4.950 6.930 N Eef1d n/a
2 TRCN0000054670 CAAGATTTGCAGCAGGCCATT pLKO.1 384 CDS 100% 4.050 5.670 N Eef1d n/a
3 TRCN0000331416 CAAGATTTGCAGCAGGCCATT pLKO_005 384 CDS 100% 4.050 5.670 N Eef1d n/a
4 TRCN0000054669 CGAGGAGGAGATCACCAAATT pLKO.1 866 CDS 100% 13.200 9.240 N Eef1d n/a
5 TRCN0000301262 CGAGGAGGAGATCACCAAATT pLKO_005 866 CDS 100% 13.200 9.240 N Eef1d n/a
6 TRCN0000054671 GATCTGGTTTGACAAGTTTAA pLKO.1 134 CDS 100% 13.200 9.240 N Eef1d n/a
7 TRCN0000301263 GATCTGGTTTGACAAGTTTAA pLKO_005 134 CDS 100% 13.200 9.240 N Eef1d n/a
8 TRCN0000054672 CATCGCAGCTTTCAACAAGAT pLKO.1 911 CDS 100% 4.950 3.465 N Eef1d n/a
9 TRCN0000301194 CATCGCAGCTTTCAACAAGAT pLKO_005 911 CDS 100% 4.950 3.465 N Eef1d n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001285434.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15404 pDONR223 0% 81.2% 85.1% None (many diffs) n/a
2 ccsbBroad304_15404 pLX_304 0% 81.2% 85.1% V5 (many diffs) n/a
3 TRCN0000470997 ATCGTCCTTTTTTCTTTTCATCTA pLX_317 52.6% 81.2% 85.1% V5 (many diffs) n/a
4 ccsbBroadEn_06140 pDONR223 100% 35.6% 37% None (many diffs) n/a
5 ccsbBroad304_06140 pLX_304 0% 35.6% 37% V5 (many diffs) n/a
6 TRCN0000467412 CATAATCATGTCTCCCTTCAGCCG pLX_317 11.8% 35.6% 37% V5 (many diffs) n/a
Download CSV