Transcript: Mouse NM_001286131.1

Mus musculus nuclear factor I/B (Nfib), transcript variant 5, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Nfib (18028)
Length:
9021
CDS:
1020..2483

Additional Resources:

NCBI RefSeq record:
NM_001286131.1
NBCI Gene record:
Nfib (18028)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001286131.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000273782 ACGTCCGTGCAATTGCCTATA pLKO_005 1087 CDS 100% 10.800 15.120 N Nfib n/a
2 TRCN0000012088 CCACAACCATAGTATAAGAAA pLKO.1 2494 3UTR 100% 5.625 7.875 N Nfib n/a
3 TRCN0000273781 CCACAACCATAGTATAAGAAA pLKO_005 2494 3UTR 100% 5.625 7.875 N Nfib n/a
4 TRCN0000012092 CCAACCATACTATCATGACAT pLKO.1 1757 CDS 100% 4.950 6.930 N Nfib n/a
5 TRCN0000273780 CAACTTCCCAATCGGAGAAAT pLKO_005 1730 CDS 100% 13.200 10.560 N Nfib n/a
6 TRCN0000012089 CCATTTATTGAGGCACTTCTT pLKO.1 1062 CDS 100% 4.950 3.960 N Nfib n/a
7 TRCN0000273732 CAGACCAGAAGGGTAAGATTA pLKO_005 1345 CDS 100% 13.200 9.240 N Nfib n/a
8 TRCN0000273731 CCACATCACAGTATCAGTTAA pLKO_005 1520 CDS 100% 13.200 9.240 N Nfib n/a
9 TRCN0000014680 CCGTGCTGTGTCTTATCCAAT pLKO.1 1323 CDS 100% 4.950 3.465 N NFIB n/a
10 TRCN0000274065 CCGTGCTGTGTCTTATCCAAT pLKO_005 1323 CDS 100% 4.950 3.465 N NFIB n/a
11 TRCN0000012090 CCTTCCAGCTACTTCTCTCAT pLKO.1 2151 CDS 100% 4.950 3.465 N Nfib n/a
12 TRCN0000012091 CCTGTTCAAAGGCATCCCTTT pLKO.1 1427 CDS 100% 0.405 0.284 N Nfib n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001286131.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01091 pDONR223 100% 80.9% 84.8% None (many diffs) n/a
2 ccsbBroad304_01091 pLX_304 0% 80.9% 84.8% V5 (many diffs) n/a
3 TRCN0000468617 CCCGTGCAGTTGAGCGCTAGTGAT pLX_317 31.4% 80.9% 84.8% V5 (many diffs) n/a
Download CSV