Transcript: Mouse NM_001286253.1

Mus musculus NAD kinase 2, mitochondrial (Nadk2), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Nadk2 (68646)
Length:
1734
CDS:
243..1400

Additional Resources:

NCBI RefSeq record:
NM_001286253.1
NBCI Gene record:
Nadk2 (68646)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001286253.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000360714 ACTACTTGAGCGACATCATAT pLKO_005 536 CDS 100% 13.200 18.480 N Nadk2 n/a
2 TRCN0000024980 CGACATCATATTCACACCAAA pLKO.1 546 CDS 100% 4.950 6.930 N Nadk2 n/a
3 TRCN0000024981 CGCAGGCTGTTGAAGATGTTT pLKO.1 1189 CDS 100% 5.625 3.938 N Nadk2 n/a
4 TRCN0000024982 CGACAAGGAAATCTGACTCTT pLKO.1 1224 CDS 100% 4.950 3.465 N Nadk2 n/a
5 TRCN0000024979 GCCGAGCCTTTAACATCGAAA pLKO.1 952 CDS 100% 4.950 3.465 N Nadk2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001286253.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04884 pDONR223 100% 48.3% 51.6% None (many diffs) n/a
2 TRCN0000466703 ACAAATACCTATTAGCCAATGAGA pLX_317 50.6% 48.3% 51.6% V5 (many diffs) n/a
3 TRCN0000487878 CTCATTTACATACACTTAACTCTT pLX_317 35.4% 48.3% 51.6% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000489766 AGCCGATCCTTTATGCTTTCGTAC pLX_317 50.2% 48.3% 51.5% V5 (many diffs) n/a
Download CSV