Transcript: Human NM_001286461.2

Homo sapiens NEDD4 binding protein 2 like 1 (N4BP2L1), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
N4BP2L1 (90634)
Length:
1751
CDS:
49..594

Additional Resources:

NCBI RefSeq record:
NM_001286461.2
NBCI Gene record:
N4BP2L1 (90634)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001286461.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000133717 GAAGTTATATTCCGAGAACCT pLKO.1 463 CDS 100% 2.640 3.696 N N4BP2L1 n/a
2 TRCN0000177658 CGCTGGAAATTCAACGTTCAA pLKO.1 490 CDS 100% 4.950 3.960 N N4bp2l1 n/a
3 TRCN0000134699 GAAACATTCATGGTGTCTCAA pLKO.1 524 CDS 100% 4.950 3.960 N N4BP2L1 n/a
4 TRCN0000136864 CCACCGAATGAAAGAACGGTA pLKO.1 555 CDS 100% 2.640 3.696 N N4BP2L1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001286461.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04524 pDONR223 100% 87.5% 66.8% None (many diffs) n/a
2 ccsbBroad304_04524 pLX_304 0% 87.5% 66.8% V5 (many diffs) n/a
3 TRCN0000466679 CAACCTTGGTTTGCCCGTACCTGC pLX_317 72.5% 87.5% 66.8% V5 (many diffs) n/a
Download CSV