Transcript: Mouse NM_001286466.1

Mus musculus beta-transducin repeat containing protein (Btrc), transcript variant 4, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Btrc (12234)
Length:
6126
CDS:
540..1691

Additional Resources:

NCBI RefSeq record:
NM_001286466.1
NBCI Gene record:
Btrc (12234)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001286466.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000012804 CGTCAGAGTGTGGGATGTAAA pLKO.1 965 CDS 100% 13.200 18.480 N Btrc n/a
2 TRCN0000432200 TGGTACGCTGCATTCGATTTG pLKO_005 1396 CDS 100% 10.800 15.120 N Btrc n/a
3 TRCN0000012806 GCGACATAGTTTACAGAGAAT pLKO.1 740 CDS 100% 4.950 6.930 N Btrc n/a
4 TRCN0000012805 CCGCCTCCAGTTTGATGAATT pLKO.1 1550 CDS 100% 0.000 0.000 N Btrc n/a
5 TRCN0000414576 TGAGACAATAGAGTCCAATTG pLKO_005 710 CDS 100% 10.800 8.640 N Btrc n/a
6 TRCN0000012807 GCCAGGCTTTGCATAAACCAA pLKO.1 355 5UTR 100% 3.000 1.800 N Btrc n/a
7 TRCN0000012803 GCCTCATAATTGCCCAGGATT pLKO.1 1706 3UTR 100% 4.950 6.930 N Btrc n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001286466.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02053 pDONR223 100% 56.8% 62.4% None (many diffs) n/a
2 ccsbBroad304_02053 pLX_304 34.3% 56.8% 62.4% V5 (many diffs) n/a
3 TRCN0000469234 CAGCAAGAGATGAGACCATGAATA pLX_317 16% 56.8% 62.4% V5 (many diffs) n/a
Download CSV