Transcript: Human NM_001286561.1

Homo sapiens nuclear mitotic apparatus protein 1 (NUMA1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
NUMA1 (4926)
Length:
7431
CDS:
437..6742

Additional Resources:

NCBI RefSeq record:
NM_001286561.1
NBCI Gene record:
NUMA1 (4926)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001286561.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000074172 GCGTTGTATCTCTGAGCTGAA pLKO.1 2635 CDS 100% 4.050 3.240 N NUMA1 n/a
2 TRCN0000286235 GCGTTGTATCTCTGAGCTGAA pLKO_005 2635 CDS 100% 4.050 3.240 N NUMA1 n/a
3 TRCN0000298552 GCAGGCAGCTGAGCACTATAA pLKO_005 5206 CDS 100% 13.200 9.240 N NUMA1 n/a
4 TRCN0000074170 CCTTGAAGAGAAGAACGAAAT pLKO.1 1561 CDS 100% 10.800 7.560 N NUMA1 n/a
5 TRCN0000333550 CCTTGAAGAGAAGAACGAAAT pLKO_005 1561 CDS 100% 10.800 7.560 N NUMA1 n/a
6 TRCN0000293771 TGGATCTAGAAGGGACCATAA pLKO_005 7082 3UTR 100% 10.800 7.560 N NUMA1 n/a
7 TRCN0000074168 CTTCTCCATCACAACCAGATT pLKO.1 7005 3UTR 100% 4.950 3.465 N NUMA1 n/a
8 TRCN0000074171 GCCTTGAAGAGAAGAACGAAA pLKO.1 1560 CDS 100% 4.950 3.465 N NUMA1 n/a
9 TRCN0000286303 GCCTTGAAGAGAAGAACGAAA pLKO_005 1560 CDS 100% 4.950 3.465 N NUMA1 n/a
10 TRCN0000074169 CCACATCTGAAGACCTGCTAT pLKO.1 6188 CDS 100% 4.950 2.970 N NUMA1 n/a
11 TRCN0000286302 CCACATCTGAAGACCTGCTAT pLKO_005 6188 CDS 100% 4.950 2.970 N NUMA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001286561.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15513 pDONR223 0% 46.5% 46.5% None 1240_4605del n/a
2 ccsbBroad304_15513 pLX_304 0% 46.5% 46.5% V5 1240_4605del n/a
3 TRCN0000468294 CCTCAGGGAAGTGGGGACGCCAAT pLX_317 7.8% 46.5% 46.5% V5 1240_4605del n/a
Download CSV