Transcript: Human NM_001286586.2

Homo sapiens CDP-diacylglycerol--inositol 3-phosphatidyltransferase (CDIPT), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
CDIPT (10423)
Length:
1758
CDS:
480..926

Additional Resources:

NCBI RefSeq record:
NM_001286586.2
NBCI Gene record:
CDIPT (10423)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001286586.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000035988 CTCGCGCTCTTAATCAAGGAA pLKO.1 445 5UTR 100% 3.000 4.200 N CDIPT n/a
2 TRCN0000333272 CTCGCGCTCTTAATCAAGGAA pLKO_005 445 5UTR 100% 3.000 4.200 N CDIPT n/a
3 TRCN0000035987 GAGTCACAAGATGATCGACTT pLKO.1 638 CDS 100% 4.050 3.240 N CDIPT n/a
4 TRCN0000333273 GAGTCACAAGATGATCGACTT pLKO_005 638 CDS 100% 4.050 3.240 N CDIPT n/a
5 TRCN0000035986 CTTCCAAATCAGCATGAGTTT pLKO.1 563 CDS 100% 4.950 3.465 N CDIPT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001286586.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02425 pDONR223 100% 69.4% 69.4% None 0_1ins195 n/a
2 ccsbBroad304_02425 pLX_304 0% 69.4% 69.4% V5 0_1ins195 n/a
3 TRCN0000468452 TTGCTATTACCCGTTAAAAGCTTC pLX_317 58.5% 69.4% 69.4% V5 0_1ins195 n/a
Download CSV