Transcript: Human NM_001286639.2

Homo sapiens MON1 homolog B, secretory trafficking associated (MON1B), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Homo sapiens (human)
Gene:
MON1B (22879)
Length:
5486
CDS:
80..1396

Additional Resources:

NCBI RefSeq record:
NM_001286639.2
NBCI Gene record:
MON1B (22879)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001286639.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000442289 GGTCTGCCTCCTAGTTGAATC pLKO_005 1716 3UTR 100% 10.800 8.640 N MON1B n/a
2 TRCN0000419210 GGGACTGGCCTGAGGGTATTT pLKO_005 1824 3UTR 100% 4.400 3.520 N MON1B n/a
3 TRCN0000421809 ACAGATCGTGAGCACACTTAC pLKO_005 337 CDS 100% 10.800 7.560 N MON1B n/a
4 TRCN0000059970 CACAAGCTGGTGTTCCTACAA pLKO.1 233 CDS 100% 4.950 3.465 N MON1B n/a
5 TRCN0000059971 CCGCTTCAACCCTGATGGTTT pLKO.1 736 CDS 100% 4.950 3.465 N MON1B n/a
6 TRCN0000426907 GTCATTGTCTCCCTAAGCAAT pLKO_005 1496 3UTR 100% 4.950 3.465 N MON1B n/a
7 TRCN0000059972 GACCTCCAAATTCGAGCTCTA pLKO.1 1198 CDS 100% 4.050 2.835 N MON1B n/a
8 TRCN0000059968 GCAATCTTGGTAGTGACCAAA pLKO.1 1253 CDS 100% 0.495 0.347 N MON1B n/a
9 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 3157 3UTR 100% 4.950 2.475 Y ERAP2 n/a
10 TRCN0000136653 GCCTGACCAACATGGTGAAAT pLKO.1 3223 3UTR 100% 13.200 6.600 Y IQCC n/a
11 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3158 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001286639.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07810 pDONR223 100% 79.9% 79.8% None 147_148ins327;546A>G;947G>A n/a
2 ccsbBroad304_07810 pLX_304 0% 79.9% 79.8% V5 147_148ins327;546A>G;947G>A n/a
3 TRCN0000479488 GGGACGCAAAGGGAGCAATGAAAT pLX_317 21.3% 79.9% 79.8% V5 147_148ins327;546A>G;947G>A n/a
Download CSV